ID: 987001945

View in Genome Browser
Species Human (GRCh38)
Location 5:13668612-13668634
Sequence ATTTGTTGCTACTAGTATTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987001945_987001947 14 Left 987001945 5:13668612-13668634 CCATAATACTAGTAGCAACAAAT No data
Right 987001947 5:13668649-13668671 GAAGTTTCAAAGAGAAAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987001945 Original CRISPR ATTTGTTGCTACTAGTATTA TGG (reversed) Intergenic
No off target data available for this crispr