ID: 987005484

View in Genome Browser
Species Human (GRCh38)
Location 5:13705643-13705665
Sequence ATCACGTTGTTAGGTGCTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 254
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 233}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987005484_987005493 6 Left 987005484 5:13705643-13705665 CCCCCAGCACCTAACAACGTGAT 0: 1
1: 0
2: 0
3: 20
4: 233
Right 987005493 5:13705672-13705694 CGGGAACAGGGTCTTTACAGAGG No data
987005484_987005494 26 Left 987005484 5:13705643-13705665 CCCCCAGCACCTAACAACGTGAT 0: 1
1: 0
2: 0
3: 20
4: 233
Right 987005494 5:13705692-13705714 AGGAAATCAAGTGAAAATGAAGG 0: 1
1: 0
2: 6
3: 60
4: 680
987005484_987005492 -6 Left 987005484 5:13705643-13705665 CCCCCAGCACCTAACAACGTGAT 0: 1
1: 0
2: 0
3: 20
4: 233
Right 987005492 5:13705660-13705682 CGTGATCTTATGCGGGAACAGGG 0: 1
1: 0
2: 1
3: 2
4: 81
987005484_987005491 -7 Left 987005484 5:13705643-13705665 CCCCCAGCACCTAACAACGTGAT 0: 1
1: 0
2: 0
3: 20
4: 233
Right 987005491 5:13705659-13705681 ACGTGATCTTATGCGGGAACAGG 0: 1
1: 0
2: 1
3: 1
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987005484 Original CRISPR ATCACGTTGTTAGGTGCTGG GGG (reversed) Intronic
900926144 1:5707377-5707399 ATCACATTCTGAGGTCCTGGGGG - Intergenic
902430196 1:16357011-16357033 ATCTCTATGTCAGGTGCTGGTGG - Intronic
903339934 1:22647436-22647458 ATCAGGCTGTTGGGTGCAGGGGG - Exonic
906699717 1:47849150-47849172 ATCACATTCTGAGGTCCTGGGGG - Intronic
907056893 1:51377790-51377812 ATCAAGGTGTTAGCTGCTGAAGG - Intronic
907230550 1:52994820-52994842 GTCCCCATGTTAGGTGCTGGTGG - Intronic
907582914 1:55588028-55588050 ATCACATTCTAAGGTCCTGGGGG + Intergenic
907703580 1:56813608-56813630 GTCACATTCTGAGGTGCTGGGGG + Intronic
907732935 1:57085505-57085527 AACACTGTGCTAGGTGCTGGGGG + Intronic
907900412 1:58736004-58736026 ATCACATTCTAAGGTACTGGGGG - Intergenic
909571960 1:77123863-77123885 GTCACGTTCTAAGGTACTGGTGG - Intronic
910162228 1:84285608-84285630 GTCACGTTCTGAGGTTCTGGGGG + Intergenic
910240858 1:85084907-85084929 ATCACATTCTGAGGTGCTGGAGG - Intronic
910377874 1:86593281-86593303 ATCAGGATGTAAGTTGCTGGTGG + Intergenic
911787757 1:101971779-101971801 ATCACGTTGTTAGGAGTATGGGG + Intronic
912076980 1:105887138-105887160 ATCACGTGCTTAGGAGTTGGAGG + Intergenic
912114233 1:106384426-106384448 ATCACATTGTGAGGTAGTGGGGG + Intergenic
912554249 1:110504611-110504633 ATCACATTCTGAGGTACTGGGGG - Intergenic
912747375 1:112256245-112256267 ATCACTGTATTAGGTGCTGTGGG - Intergenic
913160377 1:116139798-116139820 GTCACATTCTGAGGTGCTGGGGG - Intergenic
918075812 1:181170620-181170642 GTCACGTTCTGAGGTACTGGAGG - Intergenic
918551447 1:185747013-185747035 GTCACATTTTGAGGTGCTGGAGG + Intronic
922245148 1:223788657-223788679 ATCATGTTGTTAGGAGAGGGGGG + Intronic
922814048 1:228436656-228436678 GTCACATTGTGAGGTGATGGGGG + Intergenic
922892408 1:229072184-229072206 GTCACGATCTGAGGTGCTGGGGG + Intergenic
923144235 1:231186697-231186719 GTCACATTCTGAGGTGCTGGGGG + Intronic
923561323 1:235044042-235044064 CTCACATTGTTAAGTACTGGGGG - Intergenic
923768479 1:236915255-236915277 GTCACATTCTGAGGTGCTGGGGG - Intergenic
924503570 1:244659397-244659419 ATCAAGGTGTTAGGCTCTGGGGG + Intronic
1068098862 10:52527047-52527069 TTCACTTTGTTGGGTGCTGATGG - Intergenic
1068384931 10:56314142-56314164 TTCACATTCTAAGGTGCTGGGGG - Intergenic
1069138871 10:64799521-64799543 ATGACGGTATTAGGTGGTGGTGG - Intergenic
1073529725 10:104219967-104219989 GTCACATTCTGAGGTGCTGGGGG - Intronic
1075064334 10:119279297-119279319 GTCATGTTCTGAGGTGCTGGGGG + Intronic
1075557387 10:123443419-123443441 ATCACGAGGTTAGGAGATGGAGG + Intergenic
1075957656 10:126537834-126537856 ATCACATTCTGAGGTACTGGGGG - Intronic
1078428162 11:11267911-11267933 ATCACATTCTGAGGTACTGGGGG - Intergenic
1079290176 11:19181020-19181042 ATCACATTCTGAGGTACTGGGGG - Intergenic
1080308765 11:30865979-30866001 ATCACATCCTGAGGTGCTGGGGG - Intronic
1080797257 11:35576220-35576242 GTCACGTTCTGATGTGCTGGGGG + Intergenic
1083213826 11:61206247-61206269 AGCAGATTGTTAGGTGCTTGTGG + Intronic
1083216710 11:61225076-61225098 AGCAGATTGTTAGGTGCTTGTGG + Intronic
1083219592 11:61243902-61243924 AGCAGATTGTTAGGTGCTTGTGG + Intronic
1086429769 11:86725434-86725456 GTCACATTCTGAGGTGCTGGAGG - Intergenic
1086507146 11:87517633-87517655 ATCATTGTATTAGGTGCTGGAGG - Intergenic
1088885591 11:114003886-114003908 GTCACATTCTGAGGTGCTGGAGG - Intergenic
1091620996 12:2088943-2088965 ATCACGTTGTTAAATGCGGAGGG + Intronic
1092559968 12:9602030-9602052 AGTACCATGTTAGGTGCTGGTGG + Intronic
1096713485 12:53475897-53475919 AACACCTTGTTAGCTGCTGCTGG - Intronic
1100699722 12:97134457-97134479 ATCACATTGTGAGGTACCGGGGG - Intergenic
1100764611 12:97849862-97849884 GTCACGTTCTGAGGTGTTGGAGG - Intergenic
1102013526 12:109633252-109633274 AGCACTTTGGGAGGTGCTGGTGG + Intergenic
1102722774 12:115032397-115032419 TTCACATTCTGAGGTGCTGGAGG - Intergenic
1103644660 12:122381807-122381829 ATCACTTTCACAGGTGCTGGGGG - Intronic
1104099389 12:125591927-125591949 ATCACATTCACAGGTGCTGGGGG + Intronic
1104654186 12:130560882-130560904 ATCATGTTCTGAGGTTCTGGGGG - Intronic
1104914185 12:132256343-132256365 ACCACGTTGTTAGGTGTGGAAGG + Intronic
1106171741 13:27294605-27294627 GTCACATTCTGAGGTGCTGGGGG - Intergenic
1107995558 13:45856731-45856753 GTCACATTCTGAGGTGCTGGGGG - Intergenic
1108331006 13:49383957-49383979 ATCAGGTTGTTGGCTGCTGAAGG + Intronic
1109072820 13:57789990-57790012 GTCACATTCTTAGGTGCTGAGGG + Intergenic
1109157675 13:58930951-58930973 ATCACATTCTGAGGTCCTGGGGG - Intergenic
1110148293 13:72221021-72221043 AGCACGTTGTCAGGTACTGGAGG - Intergenic
1112369776 13:98784551-98784573 GTCACTTTCTGAGGTGCTGGGGG + Intergenic
1113055175 13:106259906-106259928 GTCACATTGATAGGTACTGGAGG - Intergenic
1113161716 13:107389287-107389309 GTCACATTGTGAGGTACTGGGGG - Intronic
1114356106 14:21910522-21910544 ATTACGTTCTGAGGTACTGGGGG + Intergenic
1116940265 14:50784187-50784209 CTCACGTTGTAAGGTACTGAGGG - Intronic
1117652531 14:57921835-57921857 GTCACGTTCTGAGCTGCTGGAGG + Intronic
1118071391 14:62250019-62250041 GTCACATTGTTAGGCACTGGGGG + Intergenic
1118174861 14:63428157-63428179 ATCAAGATGTTTGCTGCTGGAGG - Intronic
1120095796 14:80386360-80386382 GTCACTTTCTGAGGTGCTGGGGG - Intronic
1121716112 14:96077277-96077299 ATTATGTTGTGAGATGCTGGGGG + Intronic
1121780491 14:96618933-96618955 ATCACGTGGTTGTGTGCTGAGGG + Intergenic
1122277471 14:100602127-100602149 TTTACTTTGTTAGGTGTTGGAGG + Intergenic
1126483783 15:49156311-49156333 ATCATGTTGTAAGGAGATGGGGG + Intronic
1129155302 15:73713871-73713893 AGCACTGTGTTAGGTGCTGGGGG + Exonic
1129979824 15:79858204-79858226 ACCAGGTTGTTAGGTCCTAGAGG - Intronic
1130097841 15:80869262-80869284 GTCACATTCTGAGGTGCTGGGGG + Intronic
1130355629 15:83127445-83127467 ATCACATTGATACATGCTGGAGG + Exonic
1130958264 15:88642347-88642369 ATCACGTTCTGAGGTATTGGGGG + Intronic
1133037883 16:3044948-3044970 ATCACATTCTGAGGTACTGGGGG - Intergenic
1135580599 16:23622864-23622886 ATCTCGTTTTTCTGTGCTGGGGG - Intronic
1135836051 16:25826345-25826367 GTCACGTTCTGAGGTACTGGAGG + Intronic
1135872253 16:26161814-26161836 GTCACATTTTGAGGTGCTGGGGG - Intergenic
1137016054 16:35376599-35376621 GTCACATTCTTAGGTGCTGGGGG - Intergenic
1137412178 16:48238245-48238267 ATCAGGTTACTAGGTGCTGTGGG - Intronic
1138173118 16:54871551-54871573 GTCACATTTTTAGGTGCTGGGGG - Intergenic
1138261445 16:55626233-55626255 ATCACATTTTGAGGTACTGGGGG - Intergenic
1140731410 16:77859904-77859926 GTGACGTTGTGAGGTACTGGGGG - Intronic
1140815662 16:78618580-78618602 GTCACATTGTGAGGTACTGGGGG + Intronic
1142950201 17:3472124-3472146 ATCCGTTTGTTAGATGCTGGTGG + Exonic
1143845026 17:9767431-9767453 GTCACGTTCTAAGGTACTGGGGG + Intergenic
1144027586 17:11292217-11292239 GTCACATTCTTAGGTTCTGGTGG + Intronic
1147378075 17:40034866-40034888 AGCACTGTGCTAGGTGCTGGGGG - Intronic
1148959585 17:51382081-51382103 ATCACTGTTTTAGGTGCTGGGGG + Intergenic
1149056278 17:52370350-52370372 CTCATCTGGTTAGGTGCTGGGGG + Intergenic
1149490231 17:57079214-57079236 GTCACGTTCTGAGGTACTGGGGG + Intergenic
1149772054 17:59330499-59330521 ATCAGGATGTGAGGTGCTGCAGG - Intergenic
1149787974 17:59452570-59452592 AACACTTTGTTAGGTACTGCTGG + Intergenic
1151643654 17:75414825-75414847 GTCACATTCTTAGGTACTGGGGG - Intergenic
1153071168 18:1106460-1106482 CTCACTTTGTTAGGCTCTGGAGG + Intergenic
1153617011 18:6944480-6944502 ATCACATTCTGAGGTACTGGGGG - Intronic
1157084252 18:44562511-44562533 ATCACATTCTGATGTGCTGGGGG - Intergenic
1157541837 18:48516161-48516183 GTCACATTGAGAGGTGCTGGGGG - Intergenic
1159005014 18:63003762-63003784 ATCACATTCTGAGGTCCTGGGGG + Intergenic
1159551837 18:69903515-69903537 ATCAGGTTGTGAAGTACTGGAGG - Intronic
1165282708 19:34810851-34810873 GTCACATTCTGAGGTGCTGGGGG + Intergenic
1165534313 19:36430641-36430663 CTCACATTGTGAGGTACTGGGGG - Intergenic
1167265731 19:48482306-48482328 ATCACATTCTGAGATGCTGGGGG - Intronic
1167763393 19:51463103-51463125 GTCACTTTCTGAGGTGCTGGGGG - Intergenic
1168081456 19:54013256-54013278 GTCACATTCTTAGGTACTGGGGG + Intergenic
1168265159 19:55219326-55219348 ATCACATTCTGAGGTACTGGAGG + Intergenic
925119605 2:1407569-1407591 AGCAGGTTGTTAGGTGATGCAGG + Intronic
925478820 2:4247835-4247857 GTCACATTCTGAGGTGCTGGGGG - Intergenic
927454919 2:23241129-23241151 GTCACATTCTGAGGTGCTGGGGG + Intergenic
932196053 2:69784994-69785016 GTCACATTCTGAGGTGCTGGAGG + Intronic
933651094 2:84850856-84850878 AGCATGATGTTAGGTGGTGGAGG - Intronic
936818484 2:116489238-116489260 GTCACATTATGAGGTGCTGGGGG - Intergenic
936980792 2:118263406-118263428 ATCACGTTCTGAGGTACTGGGGG - Intergenic
938004383 2:127776091-127776113 ATCACATTGTGAGGTACTGGAGG - Intronic
939704661 2:145437566-145437588 ATCAGGTTGGTGGTTGCTGGAGG + Intergenic
941344633 2:164352357-164352379 GTCACATTGTGAGGTGCTGGGGG + Intergenic
941984884 2:171500385-171500407 ATCACATTGTGAGGTATTGGGGG + Intergenic
942073096 2:172332860-172332882 ATCACATTCTGAGGTACTGGGGG - Intergenic
943651884 2:190466218-190466240 ATCACATTTTGAGGTACTGGGGG + Intronic
945499402 2:210551827-210551849 ATCATGTTGTTAGATGATGAGGG - Intronic
945561029 2:211340479-211340501 ATCACATTCTGAGGTACTGGGGG + Intergenic
946293121 2:218760971-218760993 GTCACATTCTGAGGTGCTGGGGG + Intergenic
947235222 2:227934670-227934692 ATTACATTGTGAGGTACTGGGGG - Intergenic
1168866812 20:1093491-1093513 ATCAGGTTGTTTGGTGCTAGCGG - Intergenic
1169756381 20:9047379-9047401 ATCAGGTTGGTAGTTGCTGAAGG + Intergenic
1171193291 20:23177123-23177145 ATCACATTCTGAAGTGCTGGAGG + Intergenic
1171494701 20:25547729-25547751 ATCACATTCTGAGGTACTGGAGG + Intronic
1172376292 20:34443680-34443702 TTTACGTTGTTAGTTGCTGCCGG + Intronic
1172756259 20:37286961-37286983 ATCCCATTGTGAGGTACTGGGGG + Intergenic
1172819905 20:37722868-37722890 ATCACTCTATTAGGTGCTGGAGG - Intronic
1172909248 20:38394305-38394327 ATCACATTTTGAGGTCCTGGAGG - Intergenic
1172999550 20:39095757-39095779 ATCACATTCTGAGGTACTGGAGG + Intergenic
1173298847 20:41782715-41782737 ATCACATTCTGAGGTCCTGGGGG - Intergenic
1173459788 20:43233894-43233916 ATCACATTTTGAGGTACTGGAGG - Intergenic
1174858838 20:54070904-54070926 ATTAGGTGGTTAGGTGGTGGTGG - Intergenic
1175195658 20:57241626-57241648 GCCTCCTTGTTAGGTGCTGGGGG + Intronic
1176910723 21:14561640-14561662 GTCACATTCTGAGGTGCTGGGGG - Intronic
1178256069 21:31053592-31053614 ATCACATTCTTGGGTTCTGGAGG - Intergenic
1178748880 21:35281717-35281739 ATCACATTTTAAGGTACTGGGGG - Intronic
1178765397 21:35446050-35446072 GTCACATTCATAGGTGCTGGGGG + Intronic
1179251605 21:39675368-39675390 GTCACATTCTGAGGTGCTGGGGG + Intergenic
1180700208 22:17777459-17777481 GTCACGTTCTGAGGTCCTGGGGG - Intergenic
1185141290 22:49102737-49102759 GTCACGTTCTGCGGTGCTGGGGG - Intergenic
951460746 3:22949096-22949118 ATCACATTGTGAGGTACTGGAGG + Intergenic
951932318 3:27982055-27982077 ATGAGGTGGTTAGATGCTGGGGG + Intergenic
951954295 3:28237849-28237871 GTCACATTCTGAGGTGCTGGGGG - Intergenic
956929240 3:74023865-74023887 AGCACCTAGTTTGGTGCTGGGGG + Intergenic
957861686 3:85960043-85960065 AGCACTATGTTAGGAGCTGGGGG + Intronic
958969044 3:100590961-100590983 ATCACCTTCTAAGGTACTGGGGG - Intergenic
959108431 3:102093136-102093158 ATCAAGTGTTTAGGTGCTGATGG + Intergenic
959525035 3:107367155-107367177 ATCATGTTGTGAAGTGCTTGAGG - Intergenic
961959009 3:130834387-130834409 ATCACATTCTGAGGTACTGGAGG + Intergenic
962684724 3:137836404-137836426 ATCACATTGTGAGGCACTGGGGG - Intergenic
964399926 3:156288280-156288302 ATCACATTCTGAGGTACTGGGGG + Intronic
967329583 3:188277149-188277171 AGCACGTTGTGAGGTGGAGGCGG - Intronic
967556506 3:190864477-190864499 GTCACCTTGTTAAGTGCTGTGGG - Intronic
968437884 4:603741-603763 ATCACGTCATGAGGTACTGGGGG + Intergenic
968607941 4:1544400-1544422 GTCACATTCTGAGGTGCTGGGGG - Intergenic
969322733 4:6422780-6422802 GTCACATTCTGAGGTGCTGGGGG + Intronic
969820513 4:9716645-9716667 GTCACGTTTTGAGGTACTGGGGG - Intergenic
973228716 4:47817537-47817559 ATCAAGTTTTTAGCTTCTGGAGG + Intronic
974012100 4:56616376-56616398 GTCACGTTCTGAGGTACTGGGGG + Intergenic
975318155 4:72978929-72978951 GTCACGTTCTGAGGTACTGGGGG - Intergenic
977784469 4:101016604-101016626 GTCACATTGTGAGGTACTGGGGG + Intergenic
980636259 4:135508026-135508048 ATCACATTCTGAGGTACTGGTGG + Intergenic
982542743 4:156694887-156694909 ATCACATTCTTAGGTACTGGGGG + Intergenic
984566004 4:181330738-181330760 GTTACGTTCTTAGGTTCTGGGGG + Intergenic
984892394 4:184505345-184505367 ATCACATTCTAAGGTACTGGGGG - Intergenic
987005484 5:13705643-13705665 ATCACGTTGTTAGGTGCTGGGGG - Intronic
987957991 5:24764878-24764900 ATCACATTTTGAGGTCCTGGAGG - Intergenic
989384902 5:40845418-40845440 ATCACATTCTGAGGTACTGGGGG + Intronic
990442531 5:55861083-55861105 ATCACATTTTGAGGTACTGGGGG + Intronic
991072909 5:62505342-62505364 AACACCATGTTAGGTGCTGGGGG - Intronic
991241248 5:64462803-64462825 ATAACGTTGTTATGTGTTGTTGG - Intergenic
991715147 5:69444747-69444769 GTCACGTTCTGAGGTACTGGAGG + Intergenic
994637469 5:102361431-102361453 AGCTGGTTGTTAGGGGCTGGGGG + Intergenic
994716661 5:103329678-103329700 GTCATGTTGTGAGGTGCTGGGGG + Intergenic
999353318 5:150898917-150898939 ATCACATTTTGAGGTACTGGGGG - Intronic
1003368141 6:5496773-5496795 ATCACGTTCTGAGGTCCTGGGGG + Intronic
1004238369 6:13895979-13896001 ATCACATTTTGAGGTACTGGGGG + Intergenic
1005763038 6:28985405-28985427 CTCAAGTTGGTAGGTCCTGGGGG + Intergenic
1009288314 6:61851419-61851441 GTCACATTGTAAGGTACTGGGGG - Intronic
1012405596 6:98893548-98893570 GTCACATTCTTAGGTACTGGGGG + Intronic
1013798769 6:113915464-113915486 ATCACATTCTGAGGTACTGGGGG + Intergenic
1013875685 6:114824690-114824712 ATCCCATTGTTAGTTCCTGGAGG - Intergenic
1015389549 6:132665595-132665617 ATCACATTTTGAGGTACTGGGGG + Intergenic
1016659947 6:146566760-146566782 ATCACATTCTGAGGTACTGGAGG - Intergenic
1019791280 7:3015552-3015574 GTCACATTGTGAGGTCCTGGAGG + Intronic
1021575628 7:22103196-22103218 ATCACTTTCTGAGGTGCTGCGGG + Intergenic
1024212305 7:47216422-47216444 GTCACATTGTGAGGTCCTGGGGG + Intergenic
1024995150 7:55268534-55268556 ATCACATTCTGAGGTTCTGGGGG + Intergenic
1025003524 7:55338022-55338044 ACCATGTTTTCAGGTGCTGGTGG - Intergenic
1026342084 7:69443192-69443214 GTCACATTGTGAGGTACTGGGGG + Intergenic
1028040127 7:86041334-86041356 AGCAGGTTGTTAGGTGGGGGGGG + Intergenic
1028649848 7:93139342-93139364 GTCACATTCTAAGGTGCTGGAGG - Intronic
1029521383 7:101064867-101064889 GGCACGGTGTTAGGTGCTGTGGG - Intergenic
1029907605 7:104107215-104107237 ATCACATTCTGAGGTGCTGGGGG + Intergenic
1030170299 7:106594946-106594968 CTCAGGTAGTTTGGTGCTGGAGG + Intergenic
1031656003 7:124356482-124356504 ATCACATTTTGAGGTACTGGGGG - Intergenic
1032004388 7:128288610-128288632 GTCACATTCTGAGGTGCTGGGGG - Intergenic
1033775176 7:144601431-144601453 TTCACTTTTTTAGGTGGTGGAGG - Intronic
1034944081 7:155250750-155250772 GTCACCTTCTGAGGTGCTGGAGG - Intergenic
1036998243 8:13685619-13685641 ATCAAGTTGCTAAGTGCTGTTGG + Intergenic
1037215385 8:16445248-16445270 ATCACATTATGAGGTACTGGAGG - Intronic
1038364131 8:26913823-26913845 ATCACATTTATAGGTTCTGGTGG - Intergenic
1045479512 8:102580940-102580962 ATCACTTTCTAAGGTTCTGGAGG + Intergenic
1046186477 8:110727866-110727888 ATCACTTTCATAGGTACTGGAGG - Intergenic
1048145731 8:131841167-131841189 ATCAACTTTTTAGGTCCTGGAGG + Intergenic
1048636519 8:136301599-136301621 TTAACGTTCTTAGGTGCTGTCGG - Intergenic
1048861495 8:138727417-138727439 ATCACTGTGTGAGGTGCAGGGGG - Intronic
1049045970 8:140151654-140151676 ATCACATTCTGAGGTGCTGAGGG + Intronic
1049068502 8:140338524-140338546 GTCACATTCTGAGGTGCTGGGGG - Intronic
1049765535 8:144353654-144353676 AACACGGTCTTCGGTGCTGGGGG - Intronic
1051691251 9:19715057-19715079 ATTACGGTGTTTGGTGGTGGTGG - Intronic
1052762096 9:32603063-32603085 TTCATTTTGTTAGGTACTGGGGG + Intergenic
1053583609 9:39433580-39433602 ATCACATTATGAGGTACTGGGGG - Intergenic
1053619882 9:39803965-39803987 GTCATGTTCTTAGGTACTGGGGG + Intergenic
1053847798 9:42258434-42258456 ATCACATTATGAGGTACTGGGGG - Intergenic
1053878059 9:42563280-42563302 GTCATGTTCTTAGGTACTGGGGG + Intergenic
1053894602 9:42731085-42731107 GTCATGTTCTTAGGTACTGGGGG - Intergenic
1054105189 9:60992323-60992345 ATCACATTATGAGGTACTGGGGG - Intergenic
1054233635 9:62538414-62538436 GTCATGTTCTTAGGTACTGGGGG - Intergenic
1054264275 9:62903479-62903501 GTCATGTTCTTAGGTACTGGGGG - Intergenic
1055897385 9:81194079-81194101 ATCACATTCCTAGGTGCTGGTGG - Intergenic
1056100504 9:83296435-83296457 AGCACTGTGTTAGGTGCTGGGGG + Intronic
1056122473 9:83503120-83503142 GTCATGTTGATAGGTTCTGGGGG - Intronic
1057308814 9:93928493-93928515 GTCACGTTCTGAGGTACTGGGGG + Intergenic
1060660493 9:125402481-125402503 ATCCCCTTGATGGGTGCTGGTGG + Intergenic
1060936708 9:127520188-127520210 ATCACGTTCTGGGGTACTGGGGG - Intronic
1062150198 9:135014153-135014175 CTCACATTGTGAGGTCCTGGGGG - Intergenic
1186077442 X:5896566-5896588 ATGGCTGTGTTAGGTGCTGGGGG - Intronic
1187329010 X:18318896-18318918 ATCACATTCTGAGGTACTGGGGG - Intronic
1187946947 X:24435391-24435413 AGCACTATGCTAGGTGCTGGAGG - Intergenic
1187962933 X:24583831-24583853 CTCAGGTTGTTAGATGCTGTAGG - Intronic
1188683867 X:33045265-33045287 ATGGCATTGTTAGGTGGTGGAGG - Intronic
1189387769 X:40551320-40551342 TGCACATTGTTAGGTGCTGCTGG - Intergenic
1189801045 X:44692145-44692167 ATCATGTTCTGAGGTACTGGAGG + Intergenic
1191846792 X:65552699-65552721 GTCACATTCTGAGGTGCTGGGGG + Intergenic
1193589790 X:83375091-83375113 ATCACATTCTGAGGTACTGGGGG - Intergenic
1196376178 X:115035151-115035173 AGCACTTTGGGAGGTGCTGGCGG - Intergenic
1196763566 X:119222770-119222792 ATCACCTTGTTAACTGCTGATGG - Intergenic
1197536877 X:127700976-127700998 ATCACATTCTGAGGTACTGGAGG + Intergenic
1197882485 X:131181580-131181602 ATCAGGGTGTTAGGTGATGAAGG - Intergenic
1198208327 X:134491183-134491205 ATCAGTTTGCTAGGTGCTGGGGG - Intronic
1199813755 X:151377939-151377961 ATCACATTCTGAGGTACTGGGGG + Intergenic
1200050934 X:153431341-153431363 ATCACATTCTGAGGTACTGGGGG - Intergenic
1201671193 Y:16522757-16522779 ATCACATTCTGAGGTTCTGGGGG - Intergenic