ID: 987007421

View in Genome Browser
Species Human (GRCh38)
Location 5:13724634-13724656
Sequence CCAGTGATGAAAGTGGGGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4773
Summary {0: 1, 1: 13, 2: 187, 3: 1403, 4: 3169}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987007412_987007421 8 Left 987007412 5:13724603-13724625 CCCCTTCAAATCTCATGTTGAAA 0: 66
1: 1021
2: 1956
3: 3093
4: 6601
Right 987007421 5:13724634-13724656 CCAGTGATGAAAGTGGGGCCTGG 0: 1
1: 13
2: 187
3: 1403
4: 3169
987007413_987007421 7 Left 987007413 5:13724604-13724626 CCCTTCAAATCTCATGTTGAAAT 0: 85
1: 1201
2: 2583
3: 5965
4: 15802
Right 987007421 5:13724634-13724656 CCAGTGATGAAAGTGGGGCCTGG 0: 1
1: 13
2: 187
3: 1403
4: 3169
987007411_987007421 9 Left 987007411 5:13724602-13724624 CCCCCTTCAAATCTCATGTTGAA 0: 4
1: 78
2: 479
3: 3215
4: 13503
Right 987007421 5:13724634-13724656 CCAGTGATGAAAGTGGGGCCTGG 0: 1
1: 13
2: 187
3: 1403
4: 3169
987007414_987007421 6 Left 987007414 5:13724605-13724627 CCTTCAAATCTCATGTTGAAATG 0: 74
1: 982
2: 1826
3: 2503
4: 3102
Right 987007421 5:13724634-13724656 CCAGTGATGAAAGTGGGGCCTGG 0: 1
1: 13
2: 187
3: 1403
4: 3169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987007421 Original CRISPR CCAGTGATGAAAGTGGGGCC TGG Intronic
Too many off-targets to display for this crispr