ID: 987009963

View in Genome Browser
Species Human (GRCh38)
Location 5:13752456-13752478
Sequence GGTGTGGAATTTTCCACTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 921
Summary {0: 1, 1: 12, 2: 127, 3: 284, 4: 497}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987009963_987009967 -1 Left 987009963 5:13752456-13752478 CCCACAGTGGAAAATTCCACACC 0: 1
1: 12
2: 127
3: 284
4: 497
Right 987009967 5:13752478-13752500 CTGACCCCTATGCTTTCTGATGG 0: 1
1: 0
2: 25
3: 149
4: 334

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987009963 Original CRISPR GGTGTGGAATTTTCCACTGT GGG (reversed) Intronic
900073612 1:793798-793820 AGTATGGAATTTTCCACTTGTGG - Intergenic
901344618 1:8528946-8528968 GGAGTGGAATTTTCCACTTGTGG + Intronic
901954268 1:12772614-12772636 GCTGGGAAATGTTCCACTGTGGG + Intergenic
901956573 1:12789964-12789986 GCTGGGAAATGTTCCACTGTGGG + Intergenic
901979955 1:13026108-13026130 GCTGGGAAATGTTCCACTGTGGG + Intronic
902002132 1:13202823-13202845 GCTGGGAAATGTTCCACTGTGGG - Intergenic
902021359 1:13348563-13348585 GCTGGGAAATGTTCCACTGTGGG - Intergenic
903125436 1:21244453-21244475 GCTGTGGAACTTTCCACTGGGGG + Intronic
903407413 1:23109563-23109585 GGTATGGAATTTTCCACTTGTGG - Intronic
903904046 1:26670899-26670921 GGTATGAAATTTTCCACTTGTGG - Intergenic
904508203 1:30977244-30977266 AGTGTGGAATTTTCCACTTATGG + Intronic
905131895 1:35767523-35767545 GGTGTGGAATTTTCATCTAGTGG - Intronic
905200048 1:36309126-36309148 GGTGTGGAATTTTCCACTTAAGG + Intronic
905513019 1:38538375-38538397 GGTGTGAAATTTTCCATTTGTGG - Intergenic
905710274 1:40096475-40096497 GGTGTGGAATTTTCCACTTGTGG - Intronic
905981248 1:42230608-42230630 GGCATGGAATTTTCCACTAGTGG + Intronic
906239177 1:44231179-44231201 GGTGTGGAATTTTCCACTTGTGG + Intronic
906419177 1:45649086-45649108 GGTATGGAATTTTCTACTTGTGG + Intronic
906610404 1:47197842-47197864 CATGTGAAATTTTCCACTGGTGG + Intergenic
906767595 1:48448399-48448421 AGTGTGGAATTTTCCACTTGTGG - Intronic
907105168 1:51876525-51876547 AGTGTGGAATTTTTCACTTGTGG + Intronic
907494533 1:54834796-54834818 GGTGTGGCATTTTCCACTTGTGG + Intronic
907534289 1:55135404-55135426 GGCATGGAATTTTCCACTTGTGG - Intronic
908020712 1:59895372-59895394 GCTGTGGAGTTTTCCATTTTGGG + Intronic
908173431 1:61530233-61530255 GGTGTGGAATTTTCCACCTGTGG + Intergenic
908422950 1:63977364-63977386 GGTGTGGAATTTTTCACCTGTGG + Intronic
908423815 1:63985508-63985530 GGTGTGGAATTTTCCACCTGTGG - Intronic
908671637 1:66554518-66554540 GGTGTGGACTTTTCCACTTATGG - Intronic
909592641 1:77368739-77368761 AGTGTGGAATTTTCCACTTGTGG + Intronic
909811580 1:79938099-79938121 GCTGTGGAATTTTCTACTTGTGG - Intergenic
910145260 1:84072456-84072478 GGTATGGGATTTTCCACTCATGG - Intergenic
910181238 1:84485480-84485502 GGTGTGGAATTCCCCACTTGTGG + Intronic
910778962 1:90906420-90906442 GGTGTGGAATTTTCCATTTGTGG + Intergenic
910930712 1:92440469-92440491 ATTGTGGAATTTTCCACTTGTGG + Intergenic
910984556 1:92992944-92992966 GGTATGTAATTTTCTGCTGTGGG + Intergenic
911339953 1:96623885-96623907 GGCGTGAAATTTTCCACTTGTGG - Intergenic
911997444 1:104785003-104785025 GGTGTGAGATTTTCCACTGGTGG - Intergenic
912531750 1:110329374-110329396 TGTGTGGAAATTTCCACTTGCGG - Intergenic
912622512 1:111177374-111177396 AGTGTGGAATTTTCCACTTGTGG + Intronic
912680944 1:111728586-111728608 AGGGTAGAATTTTCCACTTTTGG - Intronic
915439761 1:155938392-155938414 GGTTTGGCATTTTCCAAGGTTGG - Intergenic
915982378 1:160428420-160428442 AATGTAGAATTTTCCACTGTTGG + Exonic
916209789 1:162350946-162350968 AGAGTGGAATTTTCCACTTGCGG - Intronic
916404726 1:164486838-164486860 GGTGTGGAATTTTCCACTTGTGG - Intergenic
916427187 1:164691848-164691870 GGTGCAGAATTTTCCACTTGTGG - Intronic
916665719 1:166965431-166965453 GGTACAGAATTTTCCACTTTTGG + Intronic
916732139 1:167575751-167575773 GGGATGAAATTTTCCACTGTGGG - Intergenic
917047440 1:170877174-170877196 GGTGTGGAATTTTCCACTTGTGG - Intergenic
917196883 1:172476282-172476304 TGTGTGGCATTTCCCACTCTGGG - Intergenic
917340341 1:173970288-173970310 AGTGTGGAATTTTCAACTTGTGG + Intronic
917908074 1:179609423-179609445 GGTATGGGATTTTCCACTTGTGG + Intronic
918092008 1:181305132-181305154 GGTGTGGAATTTTCCACTTGTGG + Intergenic
918179197 1:182071219-182071241 GGTGTAGAATTTTTCACTTTTGG - Intergenic
918397081 1:184124238-184124260 TGTGTGAAATTTTCCACTTGTGG - Intergenic
918442899 1:184586082-184586104 GTTGTGGACTTATACACTGTTGG - Intronic
918621786 1:186613793-186613815 AGTGTGGAATTTTCCACTTGTGG + Intergenic
918685361 1:187408342-187408364 GGGGTGGAATTTTCCCTTGCAGG + Intergenic
918686011 1:187416691-187416713 GGTGTAGATTTTTCCACTCATGG - Intergenic
918987836 1:191656446-191656468 GATGTGGAATTTTTCAATGGTGG + Intergenic
919002869 1:191856748-191856770 GGTGTGGAATTTTTCATTTGTGG + Intergenic
919051804 1:192520704-192520726 GGGGTGAAATTTTCCACTTGCGG - Intergenic
920659771 1:207905709-207905731 GGTGTGGAATCTTCCACTTGCGG - Intronic
920667752 1:207977552-207977574 GGTGTGAGATTTTCCACTCGTGG - Intergenic
920828199 1:209442112-209442134 GATGTGGAATTTTGCCATGTTGG - Intergenic
920840832 1:209552368-209552390 GGCGTGGAATTTTCCACATGTGG + Intergenic
920984665 1:210875309-210875331 GCTGTTGAATATTCCACTGAAGG + Intronic
921039889 1:211420348-211420370 GGTGTGAAATATTCCACTTGTGG - Intergenic
921426977 1:215014826-215014848 AGAGATGAATTTTCCACTGTTGG + Intronic
921731050 1:218578421-218578443 GGTGTGGGATTTTCTACTTGTGG - Intergenic
921735080 1:218618372-218618394 GCTGTGGAATCTTTCACTGGAGG + Intergenic
922170445 1:223150093-223150115 GTTGTGGAAATATCCCCTGTTGG + Intergenic
922269472 1:224018705-224018727 AGTATGGAATTTTCCACTTGTGG - Intergenic
922272952 1:224051303-224051325 GGTGTGGAATTTTCCACTTGTGG - Intergenic
922366307 1:224867487-224867509 CATGTGGAATTTTCCACTTGTGG + Intergenic
922772231 1:228192116-228192138 GGTCTGCAGTCTTCCACTGTGGG + Intergenic
922912424 1:229229000-229229022 AGTGTGGAATTTTCTACTTGTGG + Intergenic
922988481 1:229885275-229885297 AGGTTGGAATTTTCCACTGGTGG - Intergenic
923344799 1:233041379-233041401 GGTGTGGAATTTTTCACTTGCGG - Intronic
923688513 1:236171182-236171204 GGTGTGGAATTCTCCAGTTGTGG + Intronic
923836960 1:237622379-237622401 CGTGTAGAATTTTCCACTTGTGG - Intronic
924120504 1:240793102-240793124 GGGGTGACATTTCCCACTGTGGG + Intronic
924193020 1:241575601-241575623 TGAGTTTAATTTTCCACTGTGGG + Intronic
924481229 1:244436129-244436151 GGTATGGAACTTTCCACTTGTGG + Intronic
924616544 1:245616680-245616702 GGTGTGGAATTTTCCCCTTGTGG + Intronic
924714697 1:246562508-246562530 GGTGTCAAATTTTCCACTTTTGG - Intronic
1063430055 10:5980320-5980342 GGTGTGGAATTTTCCACTTGTGG - Intergenic
1063443699 10:6094279-6094301 GGTGTGGAATGTTCTACTTTGGG + Intronic
1063633813 10:7761590-7761612 GGTGTGGAATTTCCCACTTGTGG - Intronic
1063637911 10:7801771-7801793 GGTGTGGAATTTTCCACTTGTGG + Intronic
1064002387 10:11674497-11674519 GGGATGGAATTTTTGACTGTGGG - Intergenic
1064069326 10:12212667-12212689 GGTGTGGAATTTTCCACTTGTGG - Intronic
1064191683 10:13211933-13211955 GGTGTGGAATTTTCCCCAAAGGG + Intergenic
1064549471 10:16484392-16484414 GGTTTGGACTTTTCCACTTAAGG - Exonic
1064801131 10:19073487-19073509 GGTGTGGAATTTTCCATTTGTGG - Intronic
1065047210 10:21755008-21755030 GGTGTGAAATTTTCCACTGGTGG - Intergenic
1065129567 10:22607032-22607054 ACTGTGGAATTTTCCACTTGTGG + Intronic
1065539621 10:26749581-26749603 GGTGTGGAATTTTCCACTTGCGG + Intronic
1065877480 10:30010169-30010191 GGTGTGAAATTTTCCACTTGTGG + Intergenic
1066113410 10:32217936-32217958 TGTGTGGAATTTTCTACTTTTGG - Intergenic
1066358598 10:34709309-34709331 TGTGTGGAATTTTCCACTTGTGG + Intronic
1066432079 10:35361935-35361957 GGTGTGCAATTTTCCACTTGTGG - Intronic
1066676142 10:37889553-37889575 GGTGTGGAACTTTCCACTTGTGG - Intergenic
1067104761 10:43358884-43358906 GGTGTGGAATTTTCTACCTGTGG + Intergenic
1067300953 10:45009112-45009134 GGTGAGGAATTTTCCACTTGTGG + Intergenic
1067814525 10:49463310-49463332 GGTGTGGAATTTTCCACATCTGG + Intronic
1067934926 10:50601977-50601999 GGTGTGAAATTTTCCACTTGTGG + Intronic
1067960745 10:50846140-50846162 GGTGTGGAATTTTCTACTTGTGG - Intronic
1068325154 10:55475539-55475561 GGTGTAGGATTTTCCACTTATGG - Intronic
1068539767 10:58278792-58278814 GGTATGGAATTTTCCACTTGTGG - Intronic
1068898457 10:62235539-62235561 GGTGTAGAATTTTCCACTTGTGG - Intronic
1069104565 10:64367540-64367562 TGTGTGGAACTTTCCACTTGTGG - Intergenic
1069331194 10:67295599-67295621 GGTATGGAATCTGCCACTTTAGG - Intronic
1070180247 10:74006637-74006659 GATGTGGAATTTTCCACAAGTGG - Intronic
1070697919 10:78576647-78576669 GGTGTAGAATTTTCCACTTGTGG - Intergenic
1071272303 10:84019526-84019548 GGTTTGGAATTTTCCACTTTTGG - Intergenic
1071773347 10:88755306-88755328 GGTGTAGAATTTTTCACTTGTGG + Intergenic
1072770953 10:98136890-98136912 GGTGTGGAATTTTCCACTGGTGG + Intronic
1072985707 10:100138239-100138261 AGTGTGGAAATTTCCACTTGTGG - Intergenic
1073259667 10:102179586-102179608 GGTGTGGAATTTTTCACTTGTGG + Intergenic
1074242896 10:111656777-111656799 GGTGTGGCATTTTCCACTTGTGG + Intergenic
1074387052 10:113025020-113025042 GGTGTAGACTTTTCCACTTGTGG + Intronic
1074848331 10:117418573-117418595 GGTGTGGAAGTTTCTACTTGTGG - Intergenic
1075034957 10:119057354-119057376 GGTGTGGAATTTTACACTTGTGG - Intronic
1075672323 10:124270959-124270981 GGTGGGGTATTGTCCTCTGTGGG - Intergenic
1076291762 10:129350846-129350868 GGTGTAGAATTTTCCACTGGAGG + Intergenic
1076308518 10:129484071-129484093 GGTGTGGAATTTTCCAATTGTGG + Intronic
1076547594 10:131255840-131255862 GGTGCAGACTTTCCCACTGTTGG - Intronic
1078676614 11:13423894-13423916 GGAGTAGAATTTTTCTCTGTAGG - Intronic
1078765396 11:14292059-14292081 GGTGTGAAATTTTCCACTTGTGG + Intronic
1078829980 11:14969666-14969688 GGTGTGGAATCGCTCACTGTGGG - Intronic
1078968183 11:16371810-16371832 GGTGTAGAATTTTCTACTTCTGG + Intronic
1079074941 11:17378884-17378906 GGAATGGAATTTTCCATTGTGGG - Intergenic
1079850909 11:25533087-25533109 GCTGTGGAATATTCTATTGTTGG + Intergenic
1080028425 11:27635897-27635919 GGGATGAAATTTTCCACTGCTGG + Intergenic
1080355309 11:31437380-31437402 TATGTGGAATTTTCCACTTGTGG + Intronic
1081501130 11:43667757-43667779 TATGTGGAATTTTCCACTTAAGG + Intronic
1082309240 11:50626234-50626256 GATGTTTAATTTTTCACTGTAGG - Intergenic
1082679504 11:56151475-56151497 GGGATGGAATTTTCCATTGCAGG + Intergenic
1082881764 11:58044954-58044976 GGTGTGGAATTTTCCACTTGAGG - Intronic
1083407905 11:62471547-62471569 GGTGTGGAATTTTCCATTTGTGG + Intronic
1083590870 11:63893740-63893762 CGTGTAGAATTTTCCACTTGTGG - Intronic
1084342586 11:68516277-68516299 GGTGTGGAAACTTCCACTTGTGG - Intronic
1084933179 11:72573148-72573170 AGTGTGGAATTTTCCACTTGTGG - Intergenic
1085433577 11:76479246-76479268 GGTGTGGAATTGTCCACTTGTGG - Intronic
1085806050 11:79637213-79637235 GGTGTGGAATTTTCCACTTATGG + Intergenic
1086326091 11:85701368-85701390 GGTGTGGAATTTTCCACTTACGG + Intronic
1087111361 11:94472631-94472653 TGTGTGGAATTTACCACTTGTGG - Intronic
1087853023 11:103055197-103055219 GGTGTGGAATTTTCCACTTGTGG + Intergenic
1087888846 11:103513256-103513278 GGTGTGGAATGTTCCACTTTTGG + Intergenic
1087969059 11:104456712-104456734 GGTGTGGAATTTTCCGCTTGTGG - Intergenic
1088100675 11:106152244-106152266 TGGATGGAATTTTTCACTGTAGG - Intergenic
1088434063 11:109791169-109791191 GGTGTGGAATTTTCCCCTTGTGG - Intergenic
1088698245 11:112388784-112388806 GGGATGGAATTTTCCATTGCAGG - Intergenic
1088755513 11:112882138-112882160 GGTCTGTGATTTGCCACTGTGGG - Intergenic
1088774748 11:113071394-113071416 AGTTTGGAATTTGCCATTGTTGG + Intronic
1089011690 11:115136851-115136873 GGGCTGGGATTTTCCACTGGAGG - Intergenic
1089620435 11:119719083-119719105 AGTGTGGAATTTTCCACTTGTGG + Intronic
1089721068 11:120422225-120422247 GGTGTGAAATTTTCCATTCATGG - Intronic
1089787236 11:120916622-120916644 GGTGTGGAATTTTCCACTTGCGG - Intronic
1089925472 11:122252895-122252917 GGTGTGGAATTCTCCACTTGTGG - Intergenic
1090167639 11:124567816-124567838 GGTGTGGAATTTTCCACTTGTGG + Intergenic
1090639326 11:128717029-128717051 GCTGTGTAATTTTCCAAGGTAGG + Intronic
1091256515 11:134191956-134191978 GGTGTGAGATTTTCCACTTGTGG + Intronic
1091347111 11:134862940-134862962 GATGTAGAATTTTCCCCAGTCGG + Intergenic
1091488446 12:912223-912245 CGTGTGGAATTTTCCACTTCTGG - Exonic
1091572871 12:1705437-1705459 GGTATGGAATTTTCCACTTGTGG - Intronic
1091867136 12:3850383-3850405 GGAGTAGAATTTTCCACTTGTGG - Intronic
1092035398 12:5330157-5330179 GGTGTGGAATTTTCCACAGGTGG - Intergenic
1092259471 12:6945112-6945134 GGTGTGGAATTTTCCATTTTCGG + Intronic
1092770676 12:11893605-11893627 GGTGTGGAATTTTCCACTCATGG - Exonic
1092873511 12:12828189-12828211 GGCATGGAATTTTCCACTTGCGG - Intronic
1093189717 12:16060070-16060092 GGTGTGGAATTTTCCACTTGTGG - Intergenic
1093718162 12:22407783-22407805 GGTGTAGAATTTTTCACTTGTGG - Intronic
1094157491 12:27352322-27352344 GGTGTGGAATTTTCCACTTGTGG - Intronic
1094333036 12:29317211-29317233 TATGTGGAATTTTCCACTTGTGG - Intronic
1094401676 12:30068377-30068399 GGTGTGGAATTTTGTACTTGTGG + Intergenic
1094562439 12:31568132-31568154 GGTATGGAATTTTCCACTTGTGG - Intronic
1094638395 12:32248968-32248990 GGAATGGAATTTTCCACTGCGGG + Intronic
1095403691 12:41843865-41843887 GGTGTGGAATTTTCCACTTGTGG - Intergenic
1095472093 12:42548237-42548259 GGTGTGGAATTTTCTATTTGTGG + Intronic
1095499729 12:42823692-42823714 GGTGTGGATTTTTCCATTTTTGG + Intergenic
1095574603 12:43721858-43721880 GGTGTGGAATTTTCCATTTGTGG - Intergenic
1095724668 12:45438458-45438480 GATGTGGAATTTTCCACTCATGG - Intronic
1095923619 12:47556484-47556506 GGGATGGAATTTTCCATTGTGGG - Intergenic
1097292215 12:57927327-57927349 GGTGTTGAATTTTCCACTTGTGG + Intergenic
1097585301 12:61508194-61508216 AGTTTGGAATTTTCCACTTGTGG + Intergenic
1097601609 12:61699572-61699594 GGGATGGAATTTTTCACTGTGGG - Intergenic
1097921954 12:65085406-65085428 GGTGTGGAATTTTCCACTTGTGG + Intronic
1098118714 12:67211143-67211165 GGTGTAGAATTTTCCACTTGTGG - Intergenic
1098143657 12:67476201-67476223 GGTGTGGAATTTTTTATTCTGGG + Intergenic
1098320410 12:69238471-69238493 GGTGTGGAATTTTCCACTTGTGG + Intergenic
1098349176 12:69539549-69539571 GGTGTGAAATTTTCCACCTGTGG + Intronic
1098867166 12:75776150-75776172 GGTGAGCAATTTTCCAATTTAGG - Intergenic
1099069486 12:78027569-78027591 GGTTTGGAATTTTCCACTAGTGG - Intronic
1099149005 12:79085280-79085302 GAGGTGGAATTTTCCACTTGTGG + Intronic
1099220029 12:79902814-79902836 GGTGTGGAATTTTCCACTTGTGG - Intronic
1099368949 12:81806450-81806472 AGTGTGGAATTTTCTACTTGTGG + Intergenic
1099531100 12:83782372-83782394 GGTGTGGAATTTTCCACTTGTGG + Intergenic
1099646880 12:85368696-85368718 CATGTGGAATTTTCCACTTAGGG + Intergenic
1100034507 12:90234654-90234676 GGGATGGAATTTTTCACCGTGGG - Intergenic
1100223039 12:92526915-92526937 GATGTGGAATTTTCTACTTGTGG - Intergenic
1100340491 12:93674953-93674975 GGTGTGGAATTTTCCACTTGTGG + Intergenic
1100408580 12:94292777-94292799 GGTGCCGAATTTTCCACTTGTGG + Intronic
1100452990 12:94725615-94725637 GCTGAGGAAGTTGCCACTGTTGG - Intergenic
1100687137 12:96998826-96998848 GGTGTGGCATTTTCCACTGGTGG + Intergenic
1100766822 12:97875322-97875344 GGGATGGAATTTTTCACTGCAGG + Intergenic
1100811763 12:98345578-98345600 GGGATGAAATTTTCCATTGTGGG - Intergenic
1101147563 12:101855481-101855503 GGAATGGAATTTTCCACTGCAGG + Intergenic
1101626609 12:106449274-106449296 GGTGTGGAGTTTTCCACTTGTGG + Intronic
1102649433 12:114428270-114428292 GGTGTGGAATTTTCCACTTGTGG - Intergenic
1103876693 12:124133028-124133050 GAAGAGGAATTTTCAACTGTAGG + Intronic
1103877881 12:124142750-124142772 GGGATGGAATTTTCCACTGTGGG - Intronic
1104220306 12:126776316-126776338 GGGATGAAATTTTTCACTGTGGG - Intergenic
1105360934 13:19715516-19715538 AGTATGGAATCTTCCACTTTGGG - Intronic
1105400196 13:20085190-20085212 GGTGTGGAACTTTCCACTTTTGG + Intronic
1105646686 13:22326708-22326730 TGTGTGGAATTTTCTACTTGTGG - Intergenic
1105801950 13:23913607-23913629 AATGTGGAATTTTCCACTTGGGG + Intergenic
1105959843 13:25322511-25322533 GGTGTGGAATTTTCCACCTGTGG - Intronic
1105961690 13:25347158-25347180 GATGTGGAATTTTCCATTTGTGG + Intronic
1105982373 13:25531679-25531701 GGTGTGGAGTTTTCCACTTGTGG - Intronic
1106022836 13:25931138-25931160 GGTGTGGAATTGTCCACCCGTGG - Intronic
1106064585 13:26332971-26332993 GATGTGGAATTTTCCACTTGTGG - Intronic
1106154574 13:27141838-27141860 GGTGTGGAATTTTCCAGTTGTGG - Intronic
1106328074 13:28713958-28713980 TGTGTGGAATTTTACACTTGTGG + Intronic
1106456022 13:29927910-29927932 GGTGCGGAATTTTCCACTTGTGG + Intergenic
1106660704 13:31796868-31796890 GGTGTGGAATTTTCCACTTGTGG - Intronic
1106990917 13:35419087-35419109 TATGTGGAATTTTCCACTTATGG + Intronic
1107003453 13:35578986-35579008 TGTGTGGAATTTTCCACTTATGG + Intronic
1108002773 13:45920253-45920275 GGTGTGGACTTTCCCACTTGTGG + Intergenic
1108051885 13:46452590-46452612 GGTGTGGAATTTTCCACTTGTGG + Intergenic
1108300799 13:49073479-49073501 GGTGTGGAATTCTCCACTTGTGG - Intronic
1109064946 13:57674976-57674998 GGTTTGTGGTTTTCCACTGTAGG + Intronic
1109268878 13:60232329-60232351 GTTGGGGAATTTTCCACTTGGGG + Intergenic
1109539406 13:63753621-63753643 GGTGTGGAATTTTCCACTTGTGG - Intergenic
1109544438 13:63826213-63826235 GGTGTGGAATTTTCCACTTGTGG + Intergenic
1109831196 13:67791244-67791266 GGAATGAAATTTTCCACTGTAGG + Intergenic
1110588918 13:77230855-77230877 GGTGTGGAATTTCCCACTTGGGG + Intronic
1110837278 13:80098254-80098276 GGTGTGGAATTTTCCACTTGTGG + Intergenic
1110990120 13:82030591-82030613 GGTGTGGAATTTTCCACTTGGGG + Intergenic
1111128375 13:83941879-83941901 GGAATGGAATTTTCCACTACAGG - Intergenic
1111199805 13:84919803-84919825 AGTGTGGAATTTTTCACTTGTGG - Intergenic
1111759949 13:92450459-92450481 GGTGTGGAATTTTTCACTTGTGG + Intronic
1111764730 13:92513885-92513907 AGTGTGGAATTTTCTACTTGTGG + Intronic
1111812685 13:93111183-93111205 GGAGTGGAATTTCCCACTGCTGG - Intergenic
1112594937 13:100799199-100799221 GGCATGGAATTTTCCATTGTGGG + Intergenic
1112637360 13:101229967-101229989 GGTGTAGAATTTTTCACTTATGG - Intronic
1112787675 13:102968939-102968961 GATATGGAAATTTCCACTGTGGG + Intergenic
1112935093 13:104787212-104787234 GGTGTGGAATTTTCCACTTGTGG + Intergenic
1112962932 13:105150433-105150455 GGTGTGGAATTTTCCACTTGTGG - Intergenic
1113359474 13:109616225-109616247 GCTGTGGAATTTTCCACTTGGGG + Intergenic
1114034916 14:18614763-18614785 TGTGTGGAATTTTCCACTTGTGG - Intergenic
1114123730 14:19700253-19700275 TGTGTGGAATTTTCCACTTGTGG + Intergenic
1114173997 14:20302756-20302778 GGTGTGGAATTTTCTACTTGTGG - Intronic
1115436343 14:33378989-33379011 CGTGTGGAATTTTCCACTCGCGG - Intronic
1115735398 14:36322381-36322403 GGTGTGAAATTTTCCACTTGTGG - Intergenic
1116090980 14:40306850-40306872 GGGGTGGATTTTTCCCTTGTTGG + Intergenic
1116514110 14:45785527-45785549 GGGATGGAATTTTCCATTGTGGG - Intergenic
1116682303 14:47987946-47987968 GGTGTAAAATTTTCCACTTGTGG - Intergenic
1116842840 14:49836936-49836958 AGTGTGGAATTTTCCACCTGTGG + Intronic
1116926636 14:50645356-50645378 GGTGTGGAATTTTCTGCTTGTGG - Intronic
1117003798 14:51397715-51397737 GGTGTGGAATTTTCTACATGTGG - Intergenic
1117035529 14:51724321-51724343 GGTGTTGACTTTTCCAGTGGTGG + Intronic
1117140586 14:52787052-52787074 GATGTGGAATTTTCCACTTGTGG + Intronic
1117393723 14:55287973-55287995 GGTGTGGAATTTTCCACTTGTGG + Intronic
1117531741 14:56666480-56666502 GGAATGGAATTTTCCATTGCGGG - Intronic
1117696385 14:58368851-58368873 TGTGTGGAATTTTCCACTTGTGG + Intronic
1118142403 14:63098662-63098684 TGTGTGGAATTTTCCACTTGGGG + Intronic
1118246716 14:64117712-64117734 GGTGTGGAATTTTCCACTTCTGG + Intronic
1118278362 14:64406419-64406441 GGTGTGGAATTTTCTACTTTTGG + Intronic
1119063845 14:71505742-71505764 GGTGTGGAAATTTCCACGTGCGG - Intronic
1119090253 14:71774180-71774202 GGGATGGAATTTTCCACTGAGGG - Intergenic
1119475903 14:74928138-74928160 AGTGTGGAATTTTTCACTGGTGG + Intergenic
1119734167 14:76970688-76970710 GGTGTGGAATTTTCCACTTGTGG - Intergenic
1119953691 14:78772086-78772108 GGTATGAAATTTTCCACTTGTGG + Intronic
1120089283 14:80312427-80312449 GGTGTGGAATTTTCCATTTGTGG + Intronic
1120929595 14:89835495-89835517 GGTGTGGAATTTTCCACTTGTGG + Intronic
1120937132 14:89908434-89908456 TGTATGGAATTTTCCACTCGTGG - Intronic
1121190083 14:92019774-92019796 TGTGTGGAATTTTCCACTTGTGG - Intronic
1121373094 14:93378690-93378712 GGTGTGGAATTTTCCACTTGTGG + Intronic
1122336495 14:100991691-100991713 GATGTGGAATGTTACACTGAGGG + Intergenic
1122641531 14:103162619-103162641 GGGATGGAATTTTTCACTGAGGG + Intergenic
1125561517 15:40637564-40637586 GGTGTGAAATTTTCCATTTGTGG - Intronic
1125624373 15:41094826-41094848 GGTGTGGAATTTTCCACTTGTGG - Intronic
1125737575 15:41938111-41938133 GGTGTAGAATTTTCCACTTGTGG + Intronic
1125801809 15:42455401-42455423 GGTGTGGAATTTTCCACTGGTGG + Intronic
1125828861 15:42697595-42697617 GGTGTAGAATTTTCCACTTCCGG - Intronic
1126405930 15:48322505-48322527 GGTGAGGAATTTTCCATTTGTGG + Intergenic
1127104891 15:55603183-55603205 GGTGTGAAATTTTCCACTTGTGG - Intergenic
1127165341 15:56239611-56239633 GGTGTGGAATTTTTCACTTGTGG + Intronic
1127814728 15:62597908-62597930 GGTGTGGAATTTTCCACTTGTGG + Intronic
1128073438 15:64811422-64811444 GGTGTGGAGCTTCCCTCTGTGGG - Intergenic
1128630661 15:69263060-69263082 GATCTGGAATTTTCCACTTGTGG + Intronic
1129059055 15:72846025-72846047 TTTGTGGAATTTTCCACTTGTGG + Intergenic
1129462548 15:75706924-75706946 TGTGTGAGATTTTCCACTGGTGG - Intronic
1129722317 15:77884491-77884513 TGTGTGAGATTTTCCACTGGTGG + Intergenic
1130640917 15:85674272-85674294 TATGTGGAATTTTCCACTTGTGG - Intronic
1131351957 15:91709249-91709271 GTGGTGGAATTTTCTACTCTTGG + Intergenic
1132062487 15:98703972-98703994 GGTGTGGAATTTTCCACTTGTGG - Intronic
1132133764 15:99311235-99311257 GGTGTATAATTTTCCACTTGTGG + Intronic
1133529032 16:6636094-6636116 GGTATTGAATTTTCCACTTGTGG + Intronic
1133843887 16:9436541-9436563 GGAATGGAATTTTCCACTGCAGG - Intergenic
1135010695 16:18875180-18875202 GGTGTGGGATTTTCCACTTGGGG + Intronic
1135317582 16:21462776-21462798 GGTGTGGGATTTTCCACTTGGGG + Intergenic
1135370474 16:21894580-21894602 AGTGTGGGATTTTCCACTTGGGG + Intergenic
1135441311 16:22476123-22476145 GGTGTGGGATTTTCCACTTGGGG - Intergenic
1135467489 16:22699768-22699790 GGTGTGGAATTTTCCACTCGTGG - Intergenic
1135570255 16:23543795-23543817 GGTGTTGTATTTTCCACTTATGG - Intronic
1135807225 16:25553882-25553904 GGAATGGAATTTTCCATTGCAGG + Intergenic
1135808834 16:25569143-25569165 GGAATGGAATTTTCCATTGTGGG + Intergenic
1135813706 16:25612622-25612644 GGTGTGGTATTTTCCACTTGTGG + Intergenic
1136157763 16:28396029-28396051 GATGTGGAATTGTCCACTTATGG + Intronic
1136205324 16:28719255-28719277 GATGTGGAATTGTCCACTTATGG - Intronic
1136226710 16:28864709-28864731 GGTGTGGAATTTACAACCCTTGG - Intronic
1136314361 16:29442492-29442514 GGTGTGGGATTTTCCACTTGGGG + Intergenic
1136327800 16:29544257-29544279 GGTGTGGGATTTTCCACTTGGGG + Intergenic
1136442489 16:30284261-30284283 GGTGTGGGATTTTCCACTTGGGG + Intergenic
1138051017 16:53778484-53778506 CGTGTGGACATTTCCACTGACGG - Intronic
1138665017 16:58559162-58559184 GGTATGGAATTTTCTACTTGTGG + Intronic
1138775561 16:59719123-59719145 GGTGTAGAGTTTTCCACCTTTGG + Intronic
1138955642 16:61967668-61967690 GGGGTGGAATTTTCCACTTATGG + Intronic
1140069251 16:71634881-71634903 GTTGTGGAAGTTTCCAGTGCTGG + Intronic
1141555809 16:84836014-84836036 GGTGTGGAATTTTCCACACGTGG - Intronic
1143465952 17:7136565-7136587 GGTGTGACATTTTCCACTTGTGG - Intergenic
1143905495 17:10205814-10205836 GGGGTGGAATTTTCCATTGTGGG - Intergenic
1144993735 17:19252040-19252062 GGTGTGGAGTTTTCCACTTGTGG + Intronic
1146201530 17:30862883-30862905 GGTATGGAATTTTCCACTTAGGG - Intronic
1146414700 17:32621161-32621183 GATGTGGAATTTTCCACTTGTGG + Intronic
1147762978 17:42812792-42812814 GGTATGGAATTTTCCCCTTGTGG - Intronic
1148263106 17:46201480-46201502 CGTGTGGAATTTTCCATTTGAGG - Intronic
1148321811 17:46760773-46760795 GGTGTGGAATTTTCCACTTGTGG - Intergenic
1149279875 17:55091496-55091518 GGTGTGAAATTTTCCACTTCTGG - Intronic
1149481248 17:57005155-57005177 GGTGTGAAATGTTCCACTTGTGG + Intronic
1149933398 17:60779242-60779264 TGTGTGGAATTTTCCACTTGTGG - Intronic
1150000520 17:61434234-61434256 GATGTAGAATTTTCCACTTGTGG + Intergenic
1150070256 17:62144163-62144185 GGGATGGAATTTTCCATTGTGGG - Intergenic
1150193449 17:63268333-63268355 GGTGTGGAATTTTCCACTTGTGG - Intronic
1151138950 17:71973499-71973521 GGTGTGGAAGTTTCCACTCGTGG - Intergenic
1151614219 17:75198005-75198027 AGTGTGGAATTTTCCACTTGTGG - Intergenic
1151688361 17:75663478-75663500 GGTGTGGAACTTTCCACTTGTGG + Intronic
1152079430 17:78177277-78177299 GGTGTGGAATTTTCCACTTGTGG - Intronic
1153128174 18:1821690-1821712 AGTCTGGAATTTTCCACTTGTGG + Intergenic
1153234596 18:2973876-2973898 AGTGTGGAATTTTCCACTTGTGG + Intronic
1153651714 18:7247094-7247116 GGTGTGGAATTTTCCGTTTATGG - Intergenic
1153882166 18:9430866-9430888 GGTGTGGAGTTTTCCATTTGTGG - Intergenic
1154943803 18:21140690-21140712 AGTGTGGAATTTTCCATTTGTGG - Intergenic
1155109999 18:22705320-22705342 GATGTGGAATTTTCCACATGTGG + Intergenic
1155260024 18:24032664-24032686 GGTGTAGAATTTTTCACTTGTGG + Intronic
1155410000 18:25533404-25533426 GGGATGGAATTTTCCATTGTGGG - Intergenic
1155438776 18:25840022-25840044 AGTGTGGAATTTTCCATTTGTGG - Intergenic
1155563990 18:27112480-27112502 TGTGTGGAATTTTCCACTTGTGG + Intronic
1155585820 18:27363294-27363316 GGTGTAGAATTTTCCATTTGTGG + Intergenic
1156138480 18:34075493-34075515 GGTTTGGAATTTTCCACTTGTGG + Intronic
1156153230 18:34267793-34267815 GGTGTAAAATTTTCCACTTTTGG - Intergenic
1156304294 18:35862320-35862342 GGGATGGAATTTTCCATTGTGGG - Intergenic
1156374932 18:36504880-36504902 AGTGTGGAATTTTCTACTTGTGG - Intronic
1156732840 18:40216095-40216117 GGGATGGAATTTTCCATTGTGGG + Intergenic
1156946750 18:42842718-42842740 GGTATGGAATTTTCCACTTGTGG - Intronic
1157234444 18:45950701-45950723 GGTGTGGAATTTTCCACTTGTGG + Intronic
1157317689 18:46606439-46606461 GGTGTGGAATTTTCCACTTTTGG - Intronic
1157667281 18:49498513-49498535 GGTGTGGAATTTTCCACTTGTGG + Intergenic
1157856442 18:51109537-51109559 GGTGCGAAATATTCCACCGTGGG + Intergenic
1158089768 18:53697014-53697036 GGTGTGAAATTTTCCACTTGAGG + Intergenic
1158584939 18:58724591-58724613 GGTGTAAAATTTTCCACTTGTGG - Intronic
1158746844 18:60209940-60209962 GGTGTGAAATTTTCTACTTGTGG - Intergenic
1158952206 18:62504913-62504935 TGTGTGGAATTTACCACTTGTGG - Intergenic
1159520832 18:69520558-69520580 TGTGTAGAATTTTCAACTTTAGG - Intronic
1159604928 18:70465473-70465495 AGCGTGGAATTTTCCACTTGTGG - Intergenic
1160079400 18:75709911-75709933 GGTGTGGAATTTTTCACTTGTGG + Intergenic
1160189763 18:76706128-76706150 GGTATGAAATTTTCCACTTGTGG + Intergenic
1161673576 19:5628518-5628540 GGTGTGGAATTTTCTACTTGTGG + Intronic
1161838164 19:6661980-6662002 GTTGTGGAATTTCCCACTTGTGG + Intronic
1163174849 19:15557077-15557099 ATTGAGGAAGTTTCCACTGTGGG - Intergenic
1164920961 19:32088468-32088490 GGTGTGGAATTTTCCTCTTGTGG + Intergenic
1165276040 19:34752473-34752495 GGTGGGGAATTGGCCACTGCTGG - Intergenic
1166630680 19:44404040-44404062 GGTGTGGAATTTTCCACTTGTGG + Intergenic
1166639239 19:44480791-44480813 AGTGTAGAATTTTCCACTTGTGG + Intronic
1167732175 19:51266306-51266328 GGTGTGGAATTTTCTACTTGTGG - Intronic
925354678 2:3230489-3230511 GGTGTAAAATTTTCCACTTGTGG + Intronic
926576382 2:14586888-14586910 GGTGTGGATTTTTCCACTTGTGG + Intergenic
926895789 2:17686552-17686574 GGTGTGGAATTTTTCACTTTTGG - Intronic
927530785 2:23797797-23797819 GGTGTCAAATTTTCCACTAGTGG + Intronic
928025385 2:27735402-27735424 GGTGGGGCACTTTCCACTGCCGG - Intergenic
928121019 2:28583519-28583541 GGTGTGGAATTTTCCCCTTGTGG - Intronic
928288842 2:30019568-30019590 AGTGTGGAATTTTCCATTTGTGG - Intergenic
928393942 2:30929970-30929992 GGTGTGGAATTTGCCACCTGTGG + Intronic
928496289 2:31835967-31835989 GGTGTGGAATTTCCTACTTGTGG + Intergenic
928673651 2:33628393-33628415 TGTGTAGATTTTTCCTCTGTGGG - Intergenic
929089704 2:38202875-38202897 GGTGTGGAATTTCCCATCCTCGG + Intergenic
929614937 2:43298995-43299017 GGTGTGGAATTTTCCACTTATGG - Intronic
930178573 2:48326672-48326694 GGTGTGGAATCTTCCACTTGTGG - Intronic
930193239 2:48481841-48481863 AGTGCGGAATTTTCCACTTATGG - Intronic
930393544 2:50790885-50790907 AGTGTGGGATTTTCCACTTTTGG + Intronic
930464193 2:51724410-51724432 GGTGTGGAATTTTCCACTTGTGG + Intergenic
930502409 2:52238145-52238167 GGTGTGAAATTTTCCACTTGTGG + Intergenic
930590481 2:53321079-53321101 GGTGTGGAATTTTCCACTTGTGG + Intergenic
930758605 2:55005883-55005905 TGTGTGGAATTTTCTACTTGTGG + Intronic
931007000 2:57862083-57862105 GGTATGGAATTTTCCATTTGTGG + Intergenic
931897679 2:66751098-66751120 GCTGTATAATTTTCCACTGTGGG + Intergenic
932110329 2:68993420-68993442 GGTGTGCATTTCTCCACTGTGGG + Intergenic
932280519 2:70487566-70487588 GGTGTAGAATTTTCCATTTGTGG + Intronic
932893758 2:75618832-75618854 GCTGTGAAATTTTCCACTTGTGG + Intergenic
933230825 2:79805437-79805459 GGTGTGAAATTTTCCACATGTGG + Intronic
933407854 2:81884943-81884965 GGTTTGGAATTTTTCACTAGAGG + Intergenic
933514721 2:83286081-83286103 GGTTGGGAATTTTCTGCTGTAGG - Intergenic
933843418 2:86305745-86305767 GCTTTGGACTTTTCCTCTGTAGG + Intronic
934126933 2:88903989-88904011 GCTCTGGAATCCTCCACTGTGGG - Intergenic
934865677 2:97808210-97808232 GGTGTAGAATTTTCCACTTGTGG + Intronic
935377447 2:102413868-102413890 GGGATGGGATTTTCCACTGTAGG - Intergenic
935796538 2:106647097-106647119 GGTGGGGAAGTTTCCTGTGTGGG - Intergenic
936097589 2:109544016-109544038 GGTGGGGAATTTTCCACTTGTGG + Exonic
936827235 2:116597377-116597399 GGTGTGGAATTTTCCACCTGTGG - Intergenic
936834356 2:116689288-116689310 GGAATGGTATTTTTCACTGTGGG + Intergenic
937411917 2:121683960-121683982 GGGATGGAATTTTCCACTGTGGG - Intergenic
937504377 2:122520050-122520072 GGGATGGAATTTTCCATTGCGGG - Intergenic
937777458 2:125796157-125796179 GGTGTACAATTTTCCACTTATGG + Intergenic
937965720 2:127507837-127507859 TGTGTGGAATTTTCCACTTGTGG - Intronic
938276335 2:130028087-130028109 TGTGCGGAATTTTCCACTTGTGG + Intergenic
938306255 2:130257436-130257458 GGTGTGGAATTTTCCACTTATGG + Intergenic
938327293 2:130418848-130418870 TGTGTGGAATTTTCCACTTGTGG + Intergenic
938362646 2:130702629-130702651 TGTGTGGAATTTTCCACTTGTGG - Intergenic
938390449 2:130901161-130901183 GGTGGAGACTTCTCCACTGTTGG + Intronic
938439041 2:131309269-131309291 TGTGTGGAATTTTCCATTTGTGG - Intronic
938568749 2:132543346-132543368 GGAATGGAATTTTCCACTGTGGG + Intronic
938660764 2:133484607-133484629 GGTGTGGAATTTTCCACTTGTGG - Intronic
939128604 2:138206487-138206509 GGTGTGGAATTTCCCACTTGGGG + Intergenic
939229967 2:139411895-139411917 GATGTGGAGTTTTCCACTTGTGG + Intergenic
939265287 2:139865046-139865068 GGGATGGAATTTTCCATTGTGGG - Intergenic
939268268 2:139904079-139904101 GGTGTGCAATTTTCCATTTATGG - Intergenic
939298101 2:140296160-140296182 GGTGTGAAATTTTCCACTCGTGG - Intronic
939377326 2:141385383-141385405 GATAGGGAATTTTCCACTGGTGG - Intronic
939800057 2:146697342-146697364 GGGATGAAATTTTCCATTGTGGG + Intergenic
940428714 2:153561536-153561558 GGTGTGGAATTTCCCACTTGTGG + Intergenic
940598404 2:155824798-155824820 GGTGTGAAATTTTCCACTTGTGG - Intergenic
940984017 2:160034917-160034939 GGTGTCGAATTTTCTACTTGTGG - Intronic
941463388 2:165796515-165796537 TGTGTGGAATTTTCAACTTGTGG + Intergenic
941601221 2:167546030-167546052 GGTGTGAAATTTTTCACTTGTGG + Intergenic
941978491 2:171431215-171431237 GGAATGGAATTTTCTATTGTGGG - Intronic
941979950 2:171444396-171444418 GGTGTAAAATTTTCCACTTGTGG - Intronic
942172360 2:173300561-173300583 GGGATGGAATTTTCCATTGCAGG + Intergenic
942543909 2:177043208-177043230 GGTGTGGAGTTTTCCACTTGGGG - Intergenic
942909494 2:181225990-181226012 GGTGTGAAATTTTCTACTTGTGG - Intergenic
942935503 2:181551856-181551878 GGTGTGGAATTTTCCAGTTGTGG + Intronic
943100130 2:183478236-183478258 GGTGTGGAATTTTCCACTTGTGG - Intergenic
943203018 2:184854212-184854234 GGTATAGAATTTTCCACTTGTGG - Intronic
943422330 2:187681793-187681815 AATGTGGAGTTTTTCACTGTGGG + Intergenic
943451814 2:188051878-188051900 TGTATGGTATTTTCCACTTTTGG + Intergenic
943589477 2:189780243-189780265 GGTATGGAATTTTCCGCTTGTGG + Intronic
943634889 2:190295487-190295509 GGTGTGGAATTTTCCACTTGTGG + Intronic
943843716 2:192613478-192613500 GGTGTGAAATTTTCTACTTGTGG + Intergenic
944244081 2:197514291-197514313 GGTATGGAATTTTCCACCTGTGG - Intronic
944342514 2:198619463-198619485 GGTGTGGAAGTTTTCACTTGTGG + Intergenic
944423405 2:199555288-199555310 GGTGTGAAATTTTCCATTTGTGG - Intergenic
944469612 2:200038841-200038863 AGTGTGAAATTTTCCACTTGTGG + Intergenic
944554434 2:200873806-200873828 GATGTGGAATTTTCTACTTGTGG + Intronic
944706036 2:202289375-202289397 GGTGTGGAGTTTTCCACTTGTGG - Intronic
945358451 2:208866691-208866713 CATGTGCAATTTTCTACTGTCGG + Intergenic
945436430 2:209823930-209823952 GGTATGGAATTTTCTACTTGTGG - Intronic
945826693 2:214729346-214729368 GGTGTGGAATTTTCCACTTGTGG + Intronic
946124975 2:217554737-217554759 TGTGTGGAATTTTCTACTTATGG + Intronic
946370073 2:219275744-219275766 GGTATGGAATTTTCCACTTGTGG + Intronic
946698973 2:222391746-222391768 GGTGTGGAATTTTTCACTTGTGG - Intergenic
947175461 2:227362534-227362556 GGTATGGAATTTTCCACTTGTGG - Exonic
947187067 2:227464916-227464938 GGTGTGACATTTTCCGCTTTTGG - Intergenic
947969950 2:234314979-234315001 TGTGTGGAATTTTTCACTTGTGG + Intergenic
948052613 2:234989955-234989977 GGTGAGAAATTTTCCACTTGTGG - Intronic
948079105 2:235191041-235191063 GGTGTGAAATTTTCCTCTTGTGG + Intergenic
948126444 2:235567752-235567774 GGGTGGGAATTGTCCACTGTGGG + Intronic
948201802 2:236134709-236134731 GATGTGGAATTTTCCACTTACGG - Intergenic
948683692 2:239656967-239656989 GGTGTGAAATTTTACACTTGTGG + Intergenic
1169365602 20:4989733-4989755 GGTGCGGAATTTTCCACTCGTGG + Intronic
1169891360 20:10456014-10456036 GGTGTGGAATTTTGTACTTGTGG - Intronic
1169949711 20:11030559-11030581 AGTGTGGAATTTTCCGCTTGAGG + Intergenic
1169949715 20:11030584-11030606 AGTGTGGAATTTTCCGCTTATGG + Intergenic
1170235385 20:14097918-14097940 AGTGTTGAATTTTCCACTCGTGG + Intronic
1170284121 20:14686430-14686452 AGTGTGGAATTTTCCACTTGTGG + Intronic
1170444491 20:16411847-16411869 GGTGTGGAGTTTTCCACTTGTGG + Intronic
1170658333 20:18312226-18312248 GCTGTGGAATTTTCTACTTGTGG + Intronic
1170754067 20:19182146-19182168 ATTGTGGAATTTTCCACTTGTGG - Intergenic
1171968859 20:31550644-31550666 TGTGTGGAATTTTCCACTTGTGG - Intronic
1172085428 20:32378359-32378381 GGTGTAGAAATTTCCATTTTTGG + Intronic
1173719836 20:45246658-45246680 GGAGAGGAGTTTTCCACTTTTGG - Intergenic
1174458193 20:50664478-50664500 GGAGTGGAAATCTCCACTGAGGG + Intronic
1174614219 20:51823581-51823603 GCTGTGGAATTTTCCATCGGGGG - Intergenic
1174892006 20:54405304-54405326 GGGTTAGAATTTTCCACTGGTGG + Intergenic
1175955910 20:62609372-62609394 GGCGGGGCATTTTCCACTCTGGG - Intergenic
1176322564 21:5347705-5347727 GGTATGTCCTTTTCCACTGTAGG - Intergenic
1176480216 21:7279325-7279347 GGTATGTCCTTTTCCACTGTAGG - Intergenic
1176693295 21:9944100-9944122 GGAATGAAATTTTCCACTATGGG + Intergenic
1177330982 21:19662334-19662356 GGTGTGGAATTTTCCACTGGTGG - Intergenic
1177400080 21:20592593-20592615 GGGATGGAATTTTCCATTGTGGG + Intergenic
1177474911 21:21607408-21607430 GGTATGGAATTTTCCACTTGTGG + Intergenic
1177682370 21:24388909-24388931 GGTGTGAAATATTCTACTTTTGG + Intergenic
1178884954 21:36477789-36477811 TGTGGGGAATTTTCTACTCTGGG - Intronic
1178996653 21:37407351-37407373 GGTGTGGAGTTTTTCACTGGTGG + Intronic
1179325220 21:40335846-40335868 GGTGTTGACATTTGCACTGTTGG + Intronic
1180459036 22:15541811-15541833 TGTGTGGAATTTTCCACTTGTGG - Intergenic
1182178259 22:28316120-28316142 GGGATGGAATTTTCCATTGCAGG + Intronic
1182391321 22:29999554-29999576 AGTGTAGAATTTTCCACTTGTGG + Intronic
1182473549 22:30563208-30563230 GGTATGGAATTTTCCATTTGTGG - Intronic
1183249253 22:36717818-36717840 GGTGTGGACTTTTCCACTTGTGG + Intergenic
1183447896 22:37871403-37871425 GGTGTAGAATTTTCTACTTACGG - Intronic
1183531528 22:38356675-38356697 GGTGTGGAATTTTCCACTTTTGG + Intronic
1184360734 22:44016765-44016787 GGTGTGGAATTTTCCACTTTTGG + Intronic
949328767 3:2897755-2897777 AGTGTGAAATTTTCCACTTGTGG + Intronic
949432965 3:3998170-3998192 GGTGTGGAATTTTCCTCTTTAGG - Intronic
949628394 3:5893920-5893942 AGTGTGGAATTTTCCACTTGTGG - Intergenic
949775439 3:7627469-7627491 GGTAAGGAATTTTCCTTTGTAGG + Intronic
949862333 3:8517205-8517227 GGTGTGGAATTTTCCACTCATGG - Intronic
949938911 3:9138674-9138696 CGTGTGGGATTTTCCACTTGTGG - Intronic
950295010 3:11821910-11821932 GGTGTGGAATTTTCCACTTGTGG - Intronic
950825716 3:15818317-15818339 TTTGTGGAATTTTCCACTTGTGG - Intronic
950916716 3:16653433-16653455 CGTGTGAAATTTTCCACTTGTGG + Intronic
950942914 3:16911846-16911868 GGTATGGAATTTTCCACTTGTGG - Intronic
951086954 3:18523310-18523332 GATGTGTAATTTTCCACTTGTGG - Intergenic
951215219 3:20017814-20017836 TATGTGGAATCTTCCTCTGTAGG - Intergenic
951433443 3:22634769-22634791 GCTGAGAAATTTTCCACTATAGG + Intergenic
951488265 3:23238841-23238863 GGTGTGGAGTTTCCCACTTGTGG + Intronic
951784968 3:26407596-26407618 GGTTAGCACTTTTCCACTGTTGG + Intergenic
952108319 3:30093758-30093780 GGAACGGAATTTTCCACTGTGGG + Intergenic
952201393 3:31131961-31131983 GGTGTGTAATGTTCCATTCTGGG + Intergenic
952628786 3:35439915-35439937 GGGATGGAATTTTCCATTGCAGG - Intergenic
952799796 3:37279288-37279310 GGTGTGAAGTTTTCCACTTGTGG - Intronic
952874058 3:37927107-37927129 GGTGTGGAATTTTCCACTTGTGG - Intronic
952879988 3:37978585-37978607 AGTGTAGAATTTTCCACTTGTGG + Intronic
953270149 3:41434053-41434075 GGTGTGGAATTTTCCATTTGTGG - Intronic
953648136 3:44774105-44774127 GGGATGGAATTTTTCACCGTGGG + Intronic
954501279 3:51018723-51018745 GGTATGGCATTTTCCACTTGTGG + Intronic
955585740 3:60475775-60475797 GGGGTGGAATTTTCCACTTGTGG - Intronic
955733550 3:62012673-62012695 GGTGTGGAATTTCCCACTTGTGG + Intronic
956001017 3:64730168-64730190 GGTGTGGAATTTTCCACTTGTGG + Intergenic
956007335 3:64794882-64794904 GGTGTGGAATTTTCCGTTTGTGG + Intergenic
956612667 3:71140360-71140382 GGTGTGGAATTTTTCGCTTGTGG + Intronic
956928426 3:74015167-74015189 GGTGTGGAATTTTCTATTTGTGG - Intergenic
956987409 3:74717723-74717745 GGTATGAATTTTTCCTCTGTTGG + Intergenic
957432027 3:80123341-80123363 TGTGTGGAAGTTTCCACTTGTGG + Intergenic
958555151 3:95663689-95663711 GGTGTGGAATTTTCCACTCGTGG + Intergenic
958829581 3:99071420-99071442 GATGTGGAATTTTCCACTTGTGG + Intergenic
959032395 3:101314917-101314939 GGTGTGGAATTTGCTACTTGTGG - Intronic
959659967 3:108856747-108856769 GGTGTGGAATTTTCCACTTGTGG + Intergenic
960216814 3:115049588-115049610 GGTGTGAAATTTTCCACTTCTGG + Intronic
960379017 3:116937110-116937132 GGTGTGGAATTTTCCACTGGTGG - Intronic
960697123 3:120407064-120407086 GGTGTGAAATTTTCCACTTATGG + Intronic
960793957 3:121464649-121464671 GTTGTGGAACTTTCCACTTGTGG - Intronic
960813850 3:121653251-121653273 GGTGTGGAATTTTCTACTTGTGG + Intronic
960819871 3:121718010-121718032 GTTGTGGCATTTTCCACTTGTGG + Intronic
962131870 3:132688116-132688138 GGTGCAGAATTTTCCACTTGTGG - Intronic
962502055 3:136005096-136005118 GGTGCAGAATTTTCCACTTGTGG - Intronic
962768545 3:138591168-138591190 GGTGTGGAATTTTCTACTTGTGG - Intronic
963501765 3:146136366-146136388 GGTGTAGAATTTTACACTTGTGG - Intronic
964314297 3:155426957-155426979 GGAATGGAATTTTCAACTGCAGG + Intronic
964348851 3:155782992-155783014 GGTGTGGAATTTTCCACTTTTGG - Intronic
964727966 3:159834692-159834714 GGTGTGGAATTTTCTACTTGTGG - Intronic
964936914 3:162100807-162100829 GATGTGGAATTTTCCACTTGTGG - Intergenic
965155264 3:165044019-165044041 GGTATGGAACTTTCCACTTCTGG - Intronic
965357296 3:167692420-167692442 GACGTGGAATTTTCCACTTATGG + Intronic
965421655 3:168467022-168467044 GGTGTGGAATTTTTTACTTGTGG + Intergenic
966005155 3:175001844-175001866 GGTGTTTAATTTTCCACTTGTGG - Intronic
966167660 3:177039009-177039031 TGTGTGGAATTTTCCACTTGTGG - Intronic
966363337 3:179153423-179153445 GGTGTAGAATTTTCCACTTATGG - Intronic
966384284 3:179379026-179379048 GGTGTGGAATTTTCCACCTGTGG - Intronic
966497403 3:180596451-180596473 GGTGTGAAATTTTCCATTTGTGG - Intergenic
967386696 3:188918978-188919000 GGTGTGGAATTTCTCACTTGTGG + Intergenic
967598892 3:191360792-191360814 GGTGTGGAGTTTTCCATTGTTGG + Intronic
968489467 4:882328-882350 GGTGTGGCAGCTGCCACTGTGGG - Intronic
970189281 4:13495934-13495956 GCTGTATAATATTCCACTGTGGG - Intergenic
970589144 4:17544213-17544235 AGCCTGGAAATTTCCACTGTAGG - Intergenic
970953813 4:21787095-21787117 TGTGTGGAATTTTCCACTCATGG - Intronic
971019371 4:22518122-22518144 GGTGTGGAATTTTGCACTTGAGG - Intergenic
971297505 4:25410712-25410734 GGTATGGAATTTTCCACTAGTGG - Intronic
971696253 4:29907700-29907722 GTTTTGGTATTTTCCAGTGTAGG + Intergenic
972715476 4:41641742-41641764 GGTGTGGAATTCTCCACTTGTGG + Intronic
973692214 4:53447904-53447926 GGTGTGGAATTTTCTACTGGTGG + Intronic
973812064 4:54581189-54581211 GGTGTAGAATTTCCCACTTGTGG + Intergenic
974428878 4:61771191-61771213 GGAATGGAATTTTCCACTGTGGG + Intronic
974545715 4:63304929-63304951 GGTGTGTTATTTTCCACTAGTGG - Intergenic
974784136 4:66595856-66595878 AGTGTGGAATTTTCTACTTGTGG + Intergenic
975576219 4:75865327-75865349 GATGTGGAATTTTTCACTTGTGG + Intronic
975685046 4:76912171-76912193 GATATGGAATTTTCCACTTGTGG - Intergenic
976352828 4:84080004-84080026 AGTGTGGAATTTTCCACTTGTGG - Intergenic
976650807 4:87432356-87432378 GGTGTGGAATTTTCTATTTGTGG + Intronic
976935869 4:90631787-90631809 TATGTGGAATTTTCCACTTGTGG - Intronic
976936648 4:90644358-90644380 TGTGTGGAATTTTTCACTTGTGG + Intronic
977187388 4:93956659-93956681 GGTATAGAATTTTCCACTTGTGG + Intergenic
977211609 4:94224530-94224552 GATGTGGAATTTTCCACTCTTGG + Intronic
978222059 4:106288815-106288837 TGTGTGGAATTTTCTACTTGTGG - Intronic
978352371 4:107833489-107833511 GGTGTGGAATTTTTCATTTATGG - Intronic
978508179 4:109483447-109483469 GGTGTGGAATTTTCCACTTGTGG + Intronic
978572295 4:110151411-110151433 GGTGTGGAATTTTCCACTTTTGG + Intronic
978928767 4:114285416-114285438 GGTGTGGAATTTTCCACTTGTGG - Intergenic
979014629 4:115418372-115418394 GGGGTGGAATTTTTCAATGTGGG - Intergenic
979051236 4:115935610-115935632 AGTGTGGAATATTCCACTTGTGG - Intergenic
979602648 4:122603447-122603469 GGAATGGAATTTTCCACCGCAGG - Intergenic
979631956 4:122912994-122913016 GGTATGGAATTTTCCACTAGTGG + Intronic
979662480 4:123273653-123273675 GGTGTGGAATTTTCCACTTGAGG - Intronic
979841186 4:125442517-125442539 GGTGTGGAATTTTCCACCTGTGG - Intronic
980404700 4:132341995-132342017 GGAGTGGAATTTTCCATTTGTGG - Intergenic
980441697 4:132856140-132856162 TGTGTGGAATTTTTCACTTGTGG + Intergenic
980992661 4:139751517-139751539 GGTGTGAAATTTTCCACATGTGG + Intronic
981115376 4:140984079-140984101 GATGTAGAATTTTCCACTTGCGG + Intronic
981505879 4:145499248-145499270 GGTGCAGAATTTTCCACTTGTGG - Intronic
981729871 4:147885961-147885983 GGTATGGAATTCTCCACTTGTGG - Intronic
982536770 4:156616657-156616679 GGTGTGGAATTTTCTGCTTATGG + Intergenic
982622541 4:157725516-157725538 AGTGTGGAGTTTTCCACTTATGG - Intergenic
982708912 4:158739991-158740013 GGTGTGGAATTTTCCACTTGTGG - Intergenic
982803234 4:159731019-159731041 GTTGAAGAATTTTACACTGTTGG - Intergenic
983426879 4:167596173-167596195 GGTGTGGAGTTTTCCACTTGTGG + Intergenic
983684525 4:170392295-170392317 ACTGTGGAATTTTCCACTTGTGG + Intergenic
983686835 4:170420531-170420553 GGAACAGAATTTTCCACTGTGGG - Intergenic
983798112 4:171892006-171892028 GGTGTGGAATTTTCCACTTGTGG - Intronic
983953758 4:173673609-173673631 GGTGTGAAATTTTCTACTTGAGG + Intergenic
984174706 4:176402686-176402708 GATGTGGAATTTTCCACTTGTGG - Intergenic
984315165 4:178120204-178120226 GCTGTGGAATTTTTCACTTGTGG - Intergenic
984664348 4:182409462-182409484 GCTGCGGTATTTTCCCCTGTCGG + Intronic
984761749 4:183368368-183368390 GTTGTGGAATTTTCTACTTGCGG - Intergenic
984768412 4:183417619-183417641 GGGGTGGTATTTTGCACTGGTGG - Intergenic
986395762 5:7328331-7328353 CGTGTGGAATTGTCCACTTGTGG - Intergenic
986428381 5:7656949-7656971 TGTGTGGAATTTTCCACTTGTGG - Intronic
986566222 5:9117626-9117648 CGTGTGGAAATTTCCACTTGTGG + Intronic
986595067 5:9412803-9412825 GGTGTAGAATTTTCCACCTGTGG + Intronic
987009963 5:13752456-13752478 GGTGTGGAATTTTCCACTGTGGG - Intronic
987062476 5:14255792-14255814 GGTGTGGAATTTTCCACTTGTGG + Intronic
987187675 5:15441986-15442008 GGTGTGGGATTTTCCACTTGTGG + Intergenic
987589628 5:19907518-19907540 GGTGTGGAATTTTCTGCTTCTGG + Intronic
987951341 5:24680574-24680596 GGTGTGGAATTTTCCACTTGTGG - Intergenic
988350989 5:30106787-30106809 GGAGTGGAATTTGCCCCTGCTGG + Intergenic
988638370 5:33012962-33012984 GGTGTGGAATTTTCCACTTCTGG - Intergenic
988653989 5:33187003-33187025 GGTGTGGAATTTTCCACTCATGG + Intergenic
988783504 5:34544747-34544769 GGGATGGAATTTTCCATTGTGGG - Intergenic
988870103 5:35380022-35380044 GGTGTGTAATTTTCCACTTGTGG + Intergenic
989014546 5:36914456-36914478 GGTGTGGAATTTTCTACTTGTGG - Intronic
989173813 5:38500545-38500567 AGTGTGGAATTTTCCATTTGTGG + Intronic
989636797 5:43544686-43544708 GGTGTGGAATTTTCCACTTTTGG - Intronic
989709332 5:44378241-44378263 GGTTTGGAATTTTCTACTTGTGG + Intronic
989785464 5:45322689-45322711 AGTGTGGAATTTTTCACTTGTGG + Intronic
989974227 5:50563838-50563860 AGTGTGGAATTTTCCACTTGCGG + Intergenic
991119843 5:62999357-62999379 GGTGTGAAAATTTCCACTTGTGG + Intergenic
991229443 5:64314159-64314181 GGTGTGAAATTTTCCACTTGTGG + Intronic
991486111 5:67138771-67138793 GGTGTGGAATTTTCCACTTGTGG + Intronic
991696228 5:69275589-69275611 TGTGTAGAATTTTCCACTTGTGG - Intronic
992055711 5:72987245-72987267 GGTGTGGAATTTTCTGCTTTTGG + Intronic
992126458 5:73647130-73647152 GGTGTGGAATTTTCCTCTTGTGG - Intronic
992279902 5:75163574-75163596 GGTGTGAAATTTTTCACTCATGG + Intronic
992328668 5:75691408-75691430 TGTGTGGAATTTTTCACTTGTGG - Intronic
993197696 5:84770041-84770063 GGTTTAGAATTTTCCACTTGTGG + Intergenic
993216870 5:85035886-85035908 TGTGTGGAATTCTCCACTTATGG + Intergenic
993651410 5:90527287-90527309 GTTGTGGAATTTTCCATTTGTGG - Intronic
994264407 5:97698196-97698218 GGTGTGGAATTTGCCAGTTGTGG - Intergenic
994430301 5:99650418-99650440 GGTGTGGAATTTTCCACTTGTGG - Intergenic
994469150 5:100180206-100180228 AGTGTAGAATTTTCCACTTGTGG - Intergenic
994851009 5:105055410-105055432 GGTGTAGAATTTTCCACTTGTGG - Intergenic
994934230 5:106232997-106233019 GGTATGAAATTTTCCACTTCTGG + Intergenic
995710735 5:115032945-115032967 AGGATGGAATTTTCCATTGTGGG - Intergenic
995731927 5:115254466-115254488 TGTGTGGAATTTTTCACTTGTGG + Intronic
995863595 5:116666571-116666593 TGTGTGGAATTTTCCAATTGTGG + Intergenic
996034837 5:118747184-118747206 GGTGTGGAATTTTGCACTTGTGG - Intergenic
996198353 5:120638186-120638208 GGTGTAGAATTTTCCGCTTGGGG + Intronic
996429150 5:123351796-123351818 GGTGTAGATTTTTCCACTTGTGG + Intronic
996461230 5:123745443-123745465 GGTGTGGAATTCTCTACTTGTGG + Intergenic
996758549 5:126962539-126962561 GGTATGAAATTTTCCACTTGTGG - Intronic
997456670 5:134022585-134022607 GGGATGGAATTTTCCATTGCGGG - Intergenic
998121593 5:139582590-139582612 GGTGTGGAATTTTCTACTTGTGG + Intronic
998312375 5:141147350-141147372 TGTGTGGAATTTTCTACTTGTGG - Intronic
998590879 5:143476791-143476813 GGAGTGGAATTTTCCATTTGTGG + Intergenic
998658724 5:144211447-144211469 TATGTGGAATTTTCCACTTGTGG - Intronic
999676464 5:154008475-154008497 GGTGTGGAATTTTTCATTTGTGG - Intronic
1000638038 5:163665936-163665958 GGTGTGGAATTTTTCACTTGTGG + Intergenic
1000699431 5:164430115-164430137 GGTATGGAATTTTCCACTTGAGG - Intergenic
1001093516 5:168758897-168758919 GGTGTGGAATTTTCTACTTGTGG - Intronic
1001584338 5:172823059-172823081 GGCGTGGAGTTTTCCACTTGTGG + Intergenic
1001788395 5:174433531-174433553 GGAGAGGAATCCTCCACTGTCGG + Intergenic
1001868680 5:175130843-175130865 TATGTGGAATTTTCCACTTGTGG + Intergenic
1002151174 5:177232437-177232459 ACTGTGGAATTTTCCACTTGTGG - Intronic
1002836719 6:870950-870972 GGTGGAGAATTTTCCACTTCTGG - Intergenic
1002902930 6:1424928-1424950 GGTGTGGAATTTTCCACCTGGGG - Intergenic
1002988940 6:2219903-2219925 GGGGTGGAATTTTCCACTTCTGG - Intronic
1003090908 6:3102238-3102260 GGTGTGGTATTTTCCACTTGTGG - Intronic
1003603459 6:7539827-7539849 GGTGTGGAATTCGCCACTTGTGG - Intergenic
1003623617 6:7724226-7724248 GGTGTGGAATTTTCCATCTGAGG + Intergenic
1003884524 6:10509632-10509654 GGTGTGGAATTTTCCACTGATGG + Intronic
1003906367 6:10703552-10703574 GGTGTTGAATTTTCTACTTGAGG - Intronic
1004028730 6:11845364-11845386 GGTGTGGAATTTTCCACTTGTGG + Intergenic
1004072892 6:12318312-12318334 GGTGTGGAATTTTCTACTTGTGG + Intergenic
1004299339 6:14443100-14443122 TGTCTGGAATTTTCCACTTGTGG - Intergenic
1004488839 6:16094393-16094415 GGTGTGGAATTTCCCACTTGTGG - Intergenic
1004845483 6:19637153-19637175 GGTATTGTTTTTTCCACTGTTGG + Intergenic
1004859867 6:19792572-19792594 GGTGTGGAATGTTCCACTTGTGG + Intergenic
1004900453 6:20188756-20188778 GGGATGGAACTTTCCATTGTGGG + Intronic
1005591466 6:27332785-27332807 GGAAAGGAATTTTCCAATGTAGG + Intergenic
1006092688 6:31637278-31637300 GGTGCGGAAGACTCCACTGTAGG - Exonic
1006318151 6:33303069-33303091 GCTGTGGGATTTTCCACTTGTGG - Intronic
1006661689 6:35651728-35651750 GGTGTGGAGTTTTTCACTTGTGG - Intronic
1007904021 6:45440833-45440855 TGTGTGGAATTTTCTACTTGTGG + Intronic
1008032214 6:46709675-46709697 GATGTTGAAGTTTCCAGTGTGGG - Intronic
1008086520 6:47250887-47250909 TGTGTGGAATTTTCCACTTGTGG - Intronic
1008981795 6:57491994-57492016 GGAATGGAATTTTCTACTGCGGG + Intronic
1009169868 6:60384817-60384839 GGAATGGAATTTTCTACTGCGGG + Intergenic
1009273984 6:61651480-61651502 GGTGTGAAATTTTCCTCTTGTGG + Intergenic
1009348250 6:62644299-62644321 GGGATGGAATTTTCCATTGAGGG + Intergenic
1009636578 6:66272976-66272998 GGTGTGGAATTTTCTACTTGTGG + Intergenic
1009803004 6:68566315-68566337 GGTGTGAAATTTTCCACTTCTGG - Intergenic
1009924150 6:70099332-70099354 GGTGTAGAATTTTCCACTTGTGG - Intronic
1010529977 6:76956337-76956359 GGTGTGGAATTTTCCACTTGTGG + Intergenic
1010778913 6:79920848-79920870 GGTGTGTAATTTTCCACCTGTGG + Intronic
1011005819 6:82644388-82644410 GGTGTGGAATTTTCCACTTGTGG + Intergenic
1011018057 6:82780983-82781005 GGTGTGAAATTTTCCACTTGTGG + Intergenic
1011460408 6:87597299-87597321 GATATGGAATTTTCCACTTGTGG + Intronic
1011464186 6:87638665-87638687 GGTGTGGAATTTTCCATTTGTGG - Intronic
1011878991 6:91999467-91999489 GGTGTGGAATTTTCCACTTGTGG - Intergenic
1011968663 6:93193693-93193715 GGTATGAAATTTTCCACTAGTGG - Intergenic
1012124760 6:95414688-95414710 GGTATGAAATTTTCCACTTGTGG - Intergenic
1012127444 6:95448694-95448716 GGTGTGGAATTTTCCAACTGTGG + Intergenic
1012267182 6:97159672-97159694 GGTGTGGAATTTTCCACTTATGG - Intronic
1012498620 6:99863446-99863468 GGTGAGGAATTTTCCACGTTGGG + Intergenic
1012808002 6:103919751-103919773 GGTGTGGACATTTCCTCTCTGGG + Intergenic
1013223311 6:108099489-108099511 GGTGTGGAAGTTTCTACTTGTGG - Intronic
1013575195 6:111476494-111476516 GGTGTGGAATTTTCTACTTGTGG + Intronic
1013792370 6:113852239-113852261 GATGTGGAATTTTCCACTTGTGG + Intergenic
1013841730 6:114404191-114404213 AGTGTGGAAATTTCTACTATTGG - Intergenic
1013873708 6:114798990-114799012 CCTGGAGAATTTTCCACTGTTGG + Intergenic
1014130783 6:117829802-117829824 AGAGTGGAGTTTTCCACTCTGGG - Intergenic
1014415290 6:121176489-121176511 GGTGTGGAATTGTCCACTTGTGG - Intronic
1014558314 6:122860023-122860045 AGTGTAGAATTTTCCACTTGTGG - Intergenic
1014766602 6:125414134-125414156 GGTGTAAAATTTTTCACTTTTGG - Intergenic
1014890891 6:126844704-126844726 AGTGTGGACTTTTCCACTTGTGG + Intergenic
1015141133 6:129933168-129933190 GGTGTGGAATTTCCTACTTGCGG + Intergenic
1015924520 6:138295800-138295822 GGTGTGGAACTTTCCACTTGTGG - Intronic
1016149607 6:140723293-140723315 GGTGTAGAGTTTTCCACTTGTGG + Intergenic
1016339634 6:143049285-143049307 GGAGAGGAATTACCCACTGTGGG - Intergenic
1017118178 6:150998593-150998615 GGTGTGGAATTTTCCACTGGTGG - Intronic
1017178137 6:151524192-151524214 GGGATGGAATTTTCCATTGCAGG + Intronic
1017506804 6:155076099-155076121 GGTGCAGAATTTTCCACTTGCGG + Intronic
1017749169 6:157473691-157473713 CGTGTGAAATTTTCCATTTTTGG - Intronic
1018711856 6:166503122-166503144 TGTGTGGAATTTTCCACTGGGGG + Intronic
1018727663 6:166626631-166626653 GGTGTGGGATGGTCCCCTGTGGG - Intronic
1018872371 6:167793060-167793082 GGTGTGGAATGTTTCACTTGTGG + Intronic
1018888069 6:167958080-167958102 GGTGTGGAATTTTCTACTTGTGG - Intronic
1020715252 7:11666406-11666428 GATGTGGAATTTTCCACTTGTGG + Intronic
1020908855 7:14102770-14102792 GGTGTGAAATTTTCCACTTATGG + Intergenic
1020933804 7:14433982-14434004 GGTGTGAAAATTTCCACTTGTGG + Intronic
1021001735 7:15340276-15340298 GGTGTGGAATTTTCTAGTTGTGG + Intronic
1021271229 7:18588852-18588874 GGTATGGAATTCTCCACTTGTGG + Intronic
1021515771 7:21484369-21484391 TGTGTGGAATTTTCTACTTGTGG + Intronic
1021549810 7:21858988-21859010 GGTGTAGAATTTTCCACTTGGGG - Intronic
1021830824 7:24607004-24607026 GGTGTGGAATTTTCCACTTGTGG + Intronic
1021971566 7:25970203-25970225 GGTGTGGAATTTTCCACTTGTGG - Intergenic
1022079162 7:27002255-27002277 GTTGTGGTATTTTCCATGGTGGG - Intergenic
1022288964 7:28982823-28982845 GGACTGGAATATTCCTCTGTTGG - Intergenic
1022512136 7:30944554-30944576 GGTCTGCAATTTTCTTCTGTTGG + Intronic
1023387543 7:39675314-39675336 GGTGTAGAATTTTCTACTTGTGG + Intronic
1023608654 7:41952935-41952957 GGTATAGAATTTTCCACTTCTGG + Intergenic
1023628244 7:42137734-42137756 GGTGTGGAATTTTTCACCTGTGG - Intronic
1023724686 7:43130764-43130786 ATTGTGGAATTTTCCACTTGTGG + Intronic
1023971007 7:44990965-44990987 GGGATAGAATTTTTCACTGTAGG + Intergenic
1024258582 7:47557802-47557824 GGTGTGGAATAATTCATTGTTGG - Intronic
1024342857 7:48284858-48284880 GGGGTGGAATTGACCAATGTGGG + Intronic
1025964914 7:66260346-66260368 TGTGTGGAATTTCCCACTTGTGG + Intronic
1026001847 7:66565845-66565867 GGTGTGGAATTTCCTACTTGTGG - Intergenic
1026030947 7:66793413-66793435 GGTGTGGAATTTCCCACTTGTGG + Intronic
1026059400 7:67012689-67012711 GGTGCGAAATTTTCCACTTGTGG - Intronic
1026270717 7:68834220-68834242 GGTGTGGAATTTTCCACTCGTGG - Intergenic
1026709247 7:72722909-72722931 GGTGTGGAAGACTCCACTGCAGG - Intronic
1026718691 7:72812333-72812355 GGTGCGAAATTTTCCACTTGTGG + Intronic
1027902030 7:84128803-84128825 GGTGCGGAATTTTCCACTTGTGG - Intronic
1027956932 7:84891476-84891498 GGTGTGGAATTTTCCACTTGGGG - Intergenic
1028053720 7:86217804-86217826 GATGTGGAATGTTCCACTTGTGG + Intergenic
1028147203 7:87331104-87331126 GGGATGGAATTTTCCATTGTGGG + Intergenic
1028163108 7:87508244-87508266 TGTGTGAAATTTTCCACTTGTGG - Intronic
1028229863 7:88294187-88294209 GGTGTGGAATTATCCAATGGTGG - Intronic
1028430586 7:90743074-90743096 GGTGTGGAATTTTCCACTTGTGG + Intronic
1028800821 7:94964086-94964108 GGTGTGGAATTTTCCATTTATGG + Intronic
1028937009 7:96476520-96476542 GGTGTGAAATTTTCCACTTCTGG - Intergenic
1029050843 7:97685382-97685404 AGTGTGGAATTTTCCACTTGTGG - Intergenic
1029994727 7:104996319-104996341 AGTGTGGAATTTTCCACCTGTGG + Intergenic
1030003334 7:105089515-105089537 GGTGTAGAATTTTCTACTTGTGG - Intronic
1030616810 7:111745870-111745892 GGTGTGGAATTTTCCACTTGTGG - Intronic
1032175292 7:129618965-129618987 GGTGTGGAATTTTCCACTTGTGG + Intronic
1032555365 7:132827472-132827494 GGTGTGGAATTTTCAACTTGTGG + Intronic
1032635620 7:133704812-133704834 TGTGTGGAATTTTCCACTTGTGG + Intronic
1032671435 7:134086317-134086339 ACTGTGGAATTTTCCACTCATGG - Intergenic
1032783828 7:135185196-135185218 GGTGTGGTATTTTCCACTTGTGG - Exonic
1033012925 7:137641447-137641469 GGTGTGAAATTTTCCACTTGTGG - Intronic
1033073973 7:138231400-138231422 GGTGTGGGATTTTCCACTTGCGG + Intergenic
1033231093 7:139598099-139598121 GGTGTGGAATTTTCCACTTACGG + Intronic
1034377337 7:150657652-150657674 TGAATGGAATTTTCCACTGCAGG + Intergenic
1034395612 7:150822310-150822332 AGTGTGTAATTTTCTACTCTAGG - Intergenic
1034746399 7:153527546-153527568 GATGTGGAATTTTCCAATTGTGG + Intergenic
1034912093 7:155005028-155005050 AGTGTGGAATTTTCCATTTGTGG - Intergenic
1035494441 7:159310917-159310939 GGAATGGAATTTTCCACCATGGG + Intergenic
1035542043 8:447785-447807 AGTATGGAATTTTCCACTTGTGG + Intronic
1036435716 8:8731212-8731234 GGTGTGGAATTTTTTACTTGTGG + Intergenic
1037147097 8:15585678-15585700 GGGATGGAATTTTCCATTGTGGG + Intronic
1037318610 8:17622926-17622948 GGGATGGAATTTTTCACTGGGGG + Intronic
1038118059 8:24580107-24580129 GTTGTGGAATTTTCCACTTGTGG - Intergenic
1038178761 8:25206419-25206441 GGTCTGAAATTGGCCACTGTGGG - Intronic
1038508728 8:28109750-28109772 TGTGTGGAATTTTCCAGTTATGG + Intronic
1038765017 8:30419566-30419588 AGTGTGGAATTTTCCACTTGTGG - Intronic
1038791817 8:30674855-30674877 GGTAAAGAATTTGCCACTGTTGG - Intergenic
1038792674 8:30682347-30682369 GGTGTGGAATTTTCTGCTTGTGG - Intronic
1038886646 8:31669886-31669908 GGTGTGGAATTTTCCACTTGTGG + Intronic
1039630076 8:39101326-39101348 GGTGTGGAAATTTCCACCTGTGG - Intronic
1039865354 8:41496345-41496367 GGTTTGGAATTTCCCACTTGTGG + Intronic
1039968635 8:42302567-42302589 AGTGTGGAATTTTCCACTTCTGG - Intronic
1040008757 8:42643367-42643389 GGTGTGGAATTTTCTACTTGTGG - Intergenic
1040623011 8:49110620-49110642 GGGATGGAATTTTCCATTGCGGG - Intergenic
1040765576 8:50905982-50906004 GGTGTGGAATTTTCCACTTGTGG - Intergenic
1040919922 8:52604894-52604916 GGGGTGGAATTTTTCACTGTGGG - Intergenic
1041177431 8:55210955-55210977 GGGATGAAATTTTCCATTGTGGG + Intronic
1041307408 8:56476518-56476540 GGTGGGGAATTTTCCACTTGTGG + Intergenic
1041600647 8:59713342-59713364 GGTGTGAAATTTCCCACTTGTGG + Intergenic
1042250916 8:66755439-66755461 GGTGTGGAATATTCCACTTGTGG + Intronic
1042314770 8:67413986-67414008 GATGTGGAATTTTCCACTTGTGG + Intergenic
1042559539 8:70062837-70062859 TGTGTGGAAATTCCCACTTTTGG + Intronic
1042741056 8:72047623-72047645 TGTGTGGAATTTTCTACTTATGG - Intronic
1042756717 8:72222428-72222450 TGTGTGGAATTTTCCACTTGTGG - Intergenic
1042908340 8:73797918-73797940 AGTCTGGAATTTTCCACTTGTGG - Intronic
1043095003 8:75956535-75956557 GGTGTGGGATTTTCCACTTGTGG + Intergenic
1043269879 8:78319100-78319122 GATGTGGAATTTTCCACTTGTGG - Intergenic
1043310090 8:78848040-78848062 GGTGTGAAATTTTCCACTCGTGG + Intergenic
1043485671 8:80696909-80696931 GGTGTGGACTTTTCCATTTGTGG + Intronic
1043690846 8:83149823-83149845 GGAGTGGAATTGTCTATTGTGGG - Intergenic
1043785970 8:84400324-84400346 GGTGTGGAATTTTCCAAGTGTGG + Intronic
1043850386 8:85209703-85209725 GGTGTGGAATTTTCCATTTGTGG + Intronic
1043967277 8:86493688-86493710 GGTGTGGAATTTTCTACTTGTGG - Intronic
1044125096 8:88450536-88450558 CATGTGGAATTTTCCACTTGCGG - Intergenic
1044231532 8:89784700-89784722 GGTGTGGAATTTTCCACTTGTGG - Intronic
1045093753 8:98775260-98775282 GGTGTGGCATTTTCCATTGTGGG - Intronic
1045262341 8:100587348-100587370 GGTGTGGAATTTCCCACTTGTGG - Intronic
1045932641 8:107644976-107644998 CATGTGGTATTTTCCACTATAGG + Intergenic
1046010926 8:108546168-108546190 GGTGTGGAATTTTCCACTTGTGG + Intergenic
1046412462 8:113864240-113864262 GATGTAAAATTTTCCACTGGTGG + Intergenic
1047156533 8:122325574-122325596 GCTGCGGAAGTATCCACTGTTGG - Intergenic
1047467136 8:125127943-125127965 TGTGTGGAATTTTCCACTTGTGG + Intronic
1047475241 8:125221807-125221829 GGTGTGGAATTTTCCACATGTGG + Intronic
1047531664 8:125682441-125682463 GGTGTGAAATTTTCCACTTGTGG + Intergenic
1047606124 8:126476497-126476519 GGTGTGTGTTTTTCCACTGTGGG + Intergenic
1048238736 8:132719341-132719363 GGTGTGGAAGTTTCCACTTGTGG - Intronic
1048915572 8:139179697-139179719 GGGATGGAATATTCCATTGTGGG + Intergenic
1049047118 8:140161622-140161644 GGTGTGGAATTTTCCACTTGTGG + Intronic
1049912534 9:283326-283348 GGTGTGGAATTTTCCACTTGTGG - Intronic
1050220956 9:3389636-3389658 GGTGTGGAATTTTCTTCTTGTGG - Intronic
1050336996 9:4599194-4599216 GATGTGGAATTTTTCACTTATGG + Intronic
1050643187 9:7691197-7691219 GGTGTGGAATTTTCCATTTGTGG - Intergenic
1050727443 9:8667507-8667529 GATGTGGAATTTTTCACTTTCGG - Intronic
1051069186 9:13142598-13142620 AGTGTGGAATTTTCGTATGTGGG - Intronic
1051189485 9:14496385-14496407 GGTGTGGAATTTTCCACTTGTGG + Intergenic
1051328233 9:15996515-15996537 GGTGTGGAATTTTCGACTTGTGG + Intronic
1051650984 9:19323962-19323984 CGTGTAGAATTTTCCACTTGTGG - Intronic
1051784574 9:20728454-20728476 GGTGTGGAATTTTCAACTTGTGG + Intronic
1051835264 9:21330336-21330358 GGTGTGGAATTTTCTACTTGTGG + Exonic
1051945215 9:22560922-22560944 GGTGTGGAATTTTCCATTTGTGG + Intergenic
1051951876 9:22645588-22645610 AGTGTGGAATTTTCCACTTGTGG + Intergenic
1052293954 9:26876797-26876819 GGTGTGGAATTTCCCACTTGTGG - Intronic
1052885123 9:33638888-33638910 GGGGTGGTATTTGTCACTGTAGG - Intergenic
1053192985 9:36089565-36089587 GGTGTGGAATTTTCCACTTGTGG - Intronic
1055129431 9:72757705-72757727 GGTGTGGAATTTTTCACTTGTGG + Intronic
1055543575 9:77342344-77342366 GGTGTAGAATTTTTCACTTGTGG - Intronic
1055935716 9:81602567-81602589 GGTGTGGAATTTTCCATGTGTGG + Intronic
1057101674 9:92366925-92366947 GGTGTGGAATTTTCCACTTAAGG - Intronic
1057444135 9:95102175-95102197 GTTGTGGGATGATCCACTGTGGG + Intronic
1057562977 9:96142581-96142603 TGTGTGGAATTTTCCACTTGTGG - Intergenic
1057597769 9:96430889-96430911 GGTGTGGAATGTTCCATTTCTGG + Intergenic
1057976846 9:99614241-99614263 GGTGTAGAATTTTCCACTTGTGG - Intergenic
1058109801 9:101019494-101019516 GGTTTGTAATTTTCCCCTTTTGG - Intergenic
1058363155 9:104174671-104174693 GGTGTGGAATTTTCTACTTGTGG - Intergenic
1058473768 9:105308639-105308661 AGTATAGTATTTTCCACTGTAGG + Intronic
1058694877 9:107550698-107550720 GGTGTGGAATTTTCCACTTGTGG - Intergenic
1059190891 9:112325241-112325263 GTGATGGAATTTTTCACTGTGGG - Intronic
1059713880 9:116895141-116895163 GGTATGGAATTTTCCACCTGAGG - Intronic
1060179037 9:121519216-121519238 GGGATGGAATTTTCCATTGCAGG + Intergenic
1060319010 9:122538044-122538066 GGGATGGAATTTTCCATTGTGGG + Intergenic
1060449026 9:123719844-123719866 GGTGTGGAATTTCCCACTTGTGG + Intronic
1060614261 9:124997195-124997217 GGTGTGGAATTTTCTACTTGTGG - Intronic
1060798207 9:126526781-126526803 GGTGTGGAGTTAGCCACTCTGGG - Intergenic
1203656038 Un_KI270752v1:25643-25665 GGAGTGGAATTTGGCACTGTAGG + Intergenic
1186116663 X:6311089-6311111 GGAATGGAATTTTCCATTGCAGG + Intergenic
1186454976 X:9703661-9703683 GGTGTGGAAGTTCCCACGGTGGG - Intronic
1187008886 X:15259747-15259769 GATGTGGAATTTTCCACTTGTGG - Intronic
1187350531 X:18511161-18511183 TATGTGGAATTTTCCACTTGTGG + Intronic
1187782594 X:22844580-22844602 GGTGTGGAATTTTCCACTTGTGG - Intergenic
1187919110 X:24183586-24183608 GGTGTGGAATTTTCCACTTGTGG - Intronic
1187988128 X:24836999-24837021 GGTGTGGAATTTTTCACTCGTGG + Intronic
1188259943 X:28010748-28010770 AGTATGGAATTTTCCACTTGTGG - Intergenic
1188362862 X:29277954-29277976 GGTGTAGAATTTTCCATTTGTGG + Intronic
1188600002 X:31951303-31951325 GGTGTGAAATTTTCCACTTGTGG + Intronic
1188812629 X:34670316-34670338 GGAGTAGAATTTTCCACTTCTGG + Intergenic
1188874087 X:35408566-35408588 GGTGTGGAACTTTCCACCTGTGG - Intergenic
1188899258 X:35709874-35709896 GGTGTAGAACTTTCCACTTGTGG + Intergenic
1189633236 X:42976837-42976859 GGGATGGAATTTTCCATTGCAGG + Intergenic
1189758239 X:44294182-44294204 GGTGTGGAATTTTCCACTTGTGG + Intronic
1189768660 X:44399048-44399070 TGTGTGGAATTTTCCACTCGTGG + Intergenic
1189827714 X:44936816-44936838 GGTGTGGAATTTTCCACTTGTGG + Intronic
1190784303 X:53629240-53629262 GGTGTGGAATTTTCCACTTCTGG - Intronic
1190788167 X:53673636-53673658 GGCGTAGAATTTTCCACTTGTGG + Intronic
1191871859 X:65752779-65752801 GGTGTGAATTTTTCTACTGAAGG - Intergenic
1193056954 X:77162464-77162486 GGTGTTGAAATTTCCAGTGTGGG - Intergenic
1193380552 X:80811542-80811564 GATGTGGAATTTTCCATTTGTGG + Intergenic
1193698213 X:84735242-84735264 GGGATGGAATTTTCCACTTCTGG - Intergenic
1193954308 X:87840038-87840060 GGTATGAAATTTTCCACTTGTGG - Intergenic
1194041279 X:88944869-88944891 GGGTTGGAATTTTCCATTGTTGG - Intergenic
1194059969 X:89183691-89183713 GGGATGGAATTTTTCGCTGTGGG + Intergenic
1194107490 X:89789517-89789539 AGTGTGAAATTTTCCACTTGTGG + Intergenic
1194464586 X:94217789-94217811 GGCGTGAAATTTTCCACTTGTGG - Intergenic
1194682851 X:96874988-96875010 GGTGTGGAATATTCCATTTGTGG - Intronic
1194754170 X:97717800-97717822 TATGTGGAATTTTCCACTTGTGG + Intergenic
1195465596 X:105175619-105175641 GGTATGGTGTTTTCCACTCTGGG - Intronic
1195781317 X:108468178-108468200 GGTGTGGAATTTCCCACTTGTGG + Intronic
1196068981 X:111498457-111498479 CGTGTAGAATTTTCCACTTGTGG + Intergenic
1196291022 X:113941271-113941293 GGTATGGAATTTTCCATTCGTGG + Intergenic
1196466445 X:115976462-115976484 GGTGTGGGATTTTCATCTCTGGG + Intergenic
1196915256 X:120527732-120527754 AGTGTGGAATTTTCCACCTGTGG + Intronic
1196930780 X:120679990-120680012 GGTATGAAATTTTCCACTTGTGG + Intergenic
1196985323 X:121263742-121263764 GGTGTGGAATTTTCCACTTGTGG + Intergenic
1197288224 X:124621650-124621672 GGTGTGGAATTTTTCACTTATGG + Intronic
1197660317 X:129163532-129163554 GATGTGGAATTTTACACTTGTGG + Intergenic
1197912641 X:131501030-131501052 GGTGTGGAATTTTCCACCTGTGG - Intergenic
1198081809 X:133247266-133247288 GGGATGGAATTTTCCATTGCAGG - Intergenic
1198251853 X:134886825-134886847 GGTGTGGAATTTTCCACTTGGGG - Intergenic
1199358862 X:146893767-146893789 AGTGTAGAATTTTCCGCTGTGGG - Intergenic
1201642523 Y:16194663-16194685 GGGATGGAATTTTCCATTGCAGG + Intergenic
1201660291 Y:16390657-16390679 GGGATGGAATTTTCCATTGCAGG - Intergenic
1202027473 Y:20539921-20539943 GGAGTGGGATTTTCCTCTGTGGG + Intergenic