ID: 987011874

View in Genome Browser
Species Human (GRCh38)
Location 5:13774523-13774545
Sequence GTACTCCAGAGTCTCTCCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 121}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987011874 Original CRISPR GTACTCCAGAGTCTCTCCCC AGG (reversed) Intronic
902802925 1:18841626-18841648 GTACTCCAGAGACCCTGCCAAGG + Intronic
903476311 1:23621214-23621236 GGACTCCATAATCTCTCACCTGG + Intronic
903489723 1:23719203-23719225 GTTTTCCAGAGCCTCTTCCCTGG + Intergenic
906048559 1:42851971-42851993 TTATTCCAGAGTCCCTCCTCAGG - Exonic
906318611 1:44803485-44803507 GTACTGCACATGCTCTCCCCAGG - Intronic
908523248 1:64965511-64965533 CTCCTCCAAAGTCACTCCCCAGG - Intronic
910810682 1:91232641-91232663 GTTCTCCAGAGTATGTCCCAAGG + Intergenic
911976189 1:104498357-104498379 GGTCTCCAGAATCTCTACCCAGG + Intergenic
912007895 1:104927219-104927241 TTACTGCAGGGTCTCTCCTCAGG + Intergenic
922614475 1:226953554-226953576 GTACTCAAGAGTCTACCCCAGGG - Intronic
1063522017 10:6749770-6749792 GCACTCCACACCCTCTCCCCTGG - Intergenic
1067920508 10:50451979-50452001 GTACTACAGAGTCTCTCTCAGGG + Intronic
1068341697 10:55712504-55712526 GTACTCCAGATTCTCTGGCAAGG - Intergenic
1072433213 10:95391963-95391985 TCATTCCAGAGTCTCTCTCCTGG - Intronic
1076112479 10:127871832-127871854 AGACTCCAGAGTACCTCCCCTGG - Intergenic
1076479947 10:130778329-130778351 GTCCTGCACAGGCTCTCCCCAGG - Intergenic
1076632253 10:131858154-131858176 GACCTCCACAGTCACTCCCCTGG - Intergenic
1076679685 10:132165313-132165335 GCACAGCAGAGTCTCTCCCGGGG + Intronic
1077119532 11:900458-900480 ATCCCCCAGAGTCTCTCCCTTGG + Intronic
1078640946 11:13095594-13095616 CTTCTCAAGAGTGTCTCCCCAGG + Intergenic
1083919968 11:65777259-65777281 GCTCTCCAGAATCTCTGCCCAGG - Exonic
1088745419 11:112800598-112800620 GTACTGCAGGCTCCCTCCCCAGG + Intergenic
1090838538 11:130471017-130471039 GTACTCCGGCGTGTCTCCCCGGG + Exonic
1092933607 12:13339856-13339878 GAACTCCACATTCTCTCCCTGGG - Intergenic
1095962370 12:47843837-47843859 CTTCTCCAGACCCTCTCCCCTGG + Exonic
1101578442 12:106019613-106019635 GTTCTTCAGAGTCTCTGCACAGG - Intergenic
1101798719 12:108001870-108001892 GTCCCCCACAGTCTCTGCCCAGG - Intergenic
1106197491 13:27506884-27506906 GTACTCCTGAGTGTGTACCCAGG + Intergenic
1110856867 13:80306048-80306070 TTACTACAGATTCTTTCCCCGGG - Intergenic
1112056739 13:95695750-95695772 GAAATGGAGAGTCTCTCCCCAGG + Intronic
1112124417 13:96448694-96448716 GAACTCCAGAGGGCCTCCCCTGG + Intronic
1113096515 13:106669973-106669995 GTGCTCCAGATTCTGTCCTCAGG - Intergenic
1115755389 14:36522860-36522882 GGCCTCCAGAGTCCCTCCCATGG + Intergenic
1115961451 14:38838554-38838576 GCTCTCCACAGTCTCTCCACAGG + Intergenic
1117194595 14:53327104-53327126 ATTCTCCAGAGCCTCTCCCATGG - Intergenic
1124493294 15:30171577-30171599 GGACTCCAGCTTCTCTCCCACGG - Intergenic
1124750240 15:32366748-32366770 GGACTCCAGCTTCTCTCCCACGG + Intergenic
1127287908 15:57546743-57546765 CTGCTCTAGGGTCTCTCCCCGGG + Intronic
1127289942 15:57561220-57561242 GTCCTCCACAGCCTCTGCCCGGG - Intergenic
1129987281 15:79929255-79929277 GTATTTCAGAGTCTTTTCCCTGG + Intergenic
1134370223 16:13616702-13616724 CTCCCCCAGAGTCTCTGCCCAGG + Intergenic
1136366806 16:29812734-29812756 CTTCTCCAGGGTCTCTCCCTGGG - Intronic
1142423392 16:89987325-89987347 TTACACCACAGTGTCTCCCCCGG - Intergenic
1143855115 17:9842716-9842738 CTTCTCCAGCGCCTCTCCCCGGG + Intronic
1144453355 17:15399311-15399333 GGACACCAGTTTCTCTCCCCAGG - Intergenic
1147043146 17:37733207-37733229 ATTCTCCAGAGTATCTTCCCTGG + Intronic
1147188023 17:38723009-38723031 GCCCTCCAGAGTCTTTCACCAGG - Intronic
1147934207 17:44002179-44002201 CCACTACAGAGTCTCCCCCCCGG + Intronic
1149671933 17:58421839-58421861 CTTCTCCAGAGTTTCTTCCCTGG + Exonic
1151221284 17:72614976-72614998 GTACACAGGAGCCTCTCCCCAGG + Intergenic
1154968172 18:21380399-21380421 GTCCTCCAGGGACTCTCTCCAGG + Intronic
1155541782 18:26876145-26876167 GTACCCTAGAGCCACTCCCCTGG + Intergenic
1156159283 18:34340892-34340914 ATACACCAAAATCTCTCCCCTGG + Intergenic
1160473924 18:79166070-79166092 ATACTCCAGAGGTTCTGCCCAGG + Intronic
1161148378 19:2693563-2693585 GCAAACCAGGGTCTCTCCCCTGG + Intronic
1164483504 19:28634013-28634035 GTACTCCACAGTCACTCCCTAGG + Intergenic
1164706554 19:30324359-30324381 ACACTCCAGAGTGTCTTCCCTGG + Intronic
1164730686 19:30501964-30501986 GTATCCCAAAGTGTCTCCCCTGG - Intronic
1167330394 19:48852252-48852274 GTACTCCAGCGTCTCTCTTAAGG + Exonic
1167431881 19:49459843-49459865 GGACTCCAGGGTCTCACCCATGG - Exonic
1168251670 19:55145673-55145695 GGACTCCAGAGTCCTTCCCTGGG - Intronic
925151603 2:1618929-1618951 GTCCGGCAGAGTCTCTCCCAAGG + Intergenic
925995282 2:9287746-9287768 GGACTCCAGAGTCTCACAACTGG - Intronic
927217503 2:20676223-20676245 CTACCCCAGGGTCACTCCCCTGG - Intergenic
929803858 2:45127733-45127755 GGATAACAGAGTCTCTCCCCTGG + Intergenic
932828098 2:74959520-74959542 GTGCCACAGCGTCTCTCCCCAGG + Intronic
935212300 2:100948772-100948794 GTCCTCCTGAGGCTCTCACCTGG + Intronic
935815339 2:106842242-106842264 GTTCTCCAGAGACTCACACCAGG - Intronic
936223013 2:110619947-110619969 GTCCCCCAGATTCTGTCCCCTGG + Intergenic
937011358 2:118565529-118565551 GTACACCAGATTCTGGCCCCAGG - Intergenic
937230605 2:120396195-120396217 GGGCTCCAGAGCCTCTCGCCGGG + Intergenic
938151537 2:128889477-128889499 CTTCTGCAGAGGCTCTCCCCAGG - Intergenic
944370207 2:198973765-198973787 AGACTCCAGGGTATCTCCCCTGG + Intergenic
944699938 2:202238093-202238115 GTTCTCCAGAGACCCTCCCAGGG + Intronic
947791378 2:232871238-232871260 GTCCCCCAGAAGCTCTCCCCAGG - Intronic
1169477239 20:5942815-5942837 GTAGTCTAGAGTCACTCCACGGG - Intronic
1171355426 20:24541828-24541850 GCACTCCGGAGTCTTGCCCCAGG - Intronic
1178374405 21:32055096-32055118 GTGCTTCAGTGTCTGTCCCCAGG + Intergenic
1179321098 21:40291754-40291776 GTCCTCCAGCGTCACCCCCCAGG + Intronic
1181138713 22:20787882-20787904 GTACTGCACAGACCCTCCCCAGG - Intronic
1183009337 22:34932037-34932059 GAAGTCCAGAGCCCCTCCCCTGG - Intergenic
1183830913 22:40418006-40418028 GGACCCCACAGCCTCTCCCCGGG + Intronic
1184836160 22:47022378-47022400 ATGCTCCAGAGACTCTCTCCAGG - Intronic
951522391 3:23621754-23621776 GCACCCCAGAGCCTCTCCCTGGG + Intergenic
953614360 3:44477368-44477390 GGGCTCCAGATTCTCTACCCCGG + Intronic
955000692 3:54924782-54924804 GTTCTCCCAAGTCTCTCCCAAGG + Exonic
960146363 3:114208193-114208215 GTACCCCAAAGTCTCTCACAAGG - Intergenic
966625456 3:182011261-182011283 TTACTCCAGAGACTTTACCCAGG + Intergenic
974366011 4:60950021-60950043 GTACTCCAGAGTATCTCTGCAGG - Intergenic
974812645 4:66965088-66965110 GTACTACAAAGATTCTCCCCAGG - Intergenic
981923875 4:150116960-150116982 AGACACCAGAGTATCTCCCCTGG - Intronic
983349182 4:166565709-166565731 GTAATCCTGAATCTCTCCTCTGG + Intergenic
987011874 5:13774523-13774545 GTACTCCAGAGTCTCTCCCCAGG - Intronic
997236471 5:132274911-132274933 GGACATCAGAGTCTCTCTCCAGG + Intronic
997355993 5:133263346-133263368 TCACTCCACACTCTCTCCCCAGG - Intronic
997619491 5:135276278-135276300 TGACCCCAGGGTCTCTCCCCTGG - Intronic
998254057 5:140571489-140571511 GGCCTCCTGAGTCTCTGCCCAGG - Intronic
998354677 5:141525066-141525088 GGACTCCAGGGTTTGTCCCCAGG - Intronic
1001412259 5:171519964-171519986 TTTCTGCACAGTCTCTCCCCTGG - Intergenic
1001903570 5:175452243-175452265 TCACTGCAGAGACTCTCCCCTGG - Intergenic
1006554956 6:34858244-34858266 GACCTCCAGAGTCTCTTCCGGGG + Exonic
1008941737 6:57053684-57053706 CTACTCCAGACTTTCTTCCCAGG - Exonic
1010547562 6:77176150-77176172 GTTCTCCATAGTCTTTCACCTGG - Intergenic
1012429696 6:99151758-99151780 GGAGTCTAGAGTCTCTCCCGTGG + Intergenic
1015477848 6:133673246-133673268 AGCCTCCAGATTCTCTCCCCAGG + Intergenic
1016498376 6:144690012-144690034 GGACACCAGAGTACCTCCCCTGG - Intronic
1018869738 6:167772288-167772310 GAACTCCAGATTCCCTTCCCTGG - Intergenic
1019173326 6:170147037-170147059 GGACTCCAGTTTCTCTCCCGGGG + Intergenic
1019266413 7:119774-119796 GTTTCCCAGAGTCTGTCCCCGGG + Intergenic
1019993506 7:4708483-4708505 GTTATCCAAAGTCTCTCTCCAGG + Intronic
1023967654 7:44971248-44971270 GCACACCAGAGTCTCTGCCAAGG + Intronic
1027430081 7:78102919-78102941 GGACTCCAGAGAATCCCCCCGGG - Intronic
1028514245 7:91658888-91658910 GGCCTCCAGAGTCTGCCCCCAGG + Intergenic
1032961090 7:137035497-137035519 GTACTCCTGAGTTTATCCCAGGG + Intergenic
1034131503 7:148722571-148722593 GAACTCCAGAGTCTTTCTCTGGG - Intronic
1036592590 8:10182428-10182450 CTACTTCAGAGTCTCTCACAAGG + Intronic
1036778154 8:11627928-11627950 GCCCTCCAGATTCTCTTCCCTGG - Intergenic
1038958356 8:32491582-32491604 GTACTAGAGATTCTCTCCCTGGG + Intronic
1038959303 8:32501011-32501033 GTACTCCAGAGTACCTGCCAAGG + Intronic
1039912266 8:41834737-41834759 GTGCTCCGGAATCCCTCCCCAGG - Intronic
1041254026 8:55963541-55963563 CTGCTCCAGAGTCCCTCCCAAGG + Intronic
1045734409 8:105278133-105278155 GTACTTCAGAGTAGCTCTCCAGG - Intronic
1047572555 8:126115601-126115623 GCTCTCCATAGTCTGTCCCCAGG - Intergenic
1050776788 9:9273628-9273650 GTACTCTAGAGTGTCTACCCAGG + Intronic
1051049410 9:12913740-12913762 CAATTCCAGATTCTCTCCCCAGG + Intergenic
1056976670 9:91263032-91263054 GTACTCCACATGTTCTCCCCAGG + Intronic
1057834203 9:98431038-98431060 GAACTCCAGATACTCTCACCTGG + Intronic
1062685588 9:137811352-137811374 ATGCTCCAGAGCCTCTCCCCGGG + Intronic