ID: 987013890

View in Genome Browser
Species Human (GRCh38)
Location 5:13797374-13797396
Sequence ATCCTTTGCCCACTATTGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 9068
Summary {0: 1, 1: 33, 2: 122, 3: 778, 4: 8134}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987013890_987013893 22 Left 987013890 5:13797374-13797396 CCCATCAATAGTGGGCAAAGGAT 0: 1
1: 33
2: 122
3: 778
4: 8134
Right 987013893 5:13797419-13797441 AAGACATCTATGCAGCCAACAGG 0: 3
1: 60
2: 78
3: 56
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987013890 Original CRISPR ATCCTTTGCCCACTATTGAT GGG (reversed) Intronic
Too many off-targets to display for this crispr