ID: 987016184 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 5:13822356-13822378 |
| Sequence | CTCTGGATGCTGAGGTGGGA GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 4639 | |||
| Summary | {0: 1, 1: 43, 2: 524, 3: 1353, 4: 2718} |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 987016184_987016193 | 0 | Left | 987016184 | 5:13822356-13822378 | CCCTCCCACCTCAGCATCCAGAG | 0: 1 1: 43 2: 524 3: 1353 4: 2718 |
||
| Right | 987016193 | 5:13822379-13822401 | TAGATGGGACTATAGGCACATGG | 0: 1 1: 14 2: 146 3: 540 4: 1414 |
||||
| 987016184_987016191 | -7 | Left | 987016184 | 5:13822356-13822378 | CCCTCCCACCTCAGCATCCAGAG | 0: 1 1: 43 2: 524 3: 1353 4: 2718 |
||
| Right | 987016191 | 5:13822372-13822394 | TCCAGAGTAGATGGGACTATAGG | 0: 7 1: 474 2: 13152 3: 134596 4: 261264 |
||||
| 987016184_987016194 | 24 | Left | 987016184 | 5:13822356-13822378 | CCCTCCCACCTCAGCATCCAGAG | 0: 1 1: 43 2: 524 3: 1353 4: 2718 |
||
| Right | 987016194 | 5:13822403-13822425 | ACCATGCCCAACTAATTTTTTGG | 0: 5 1: 117 2: 340 3: 671 4: 899 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 987016184 | Original CRISPR | CTCTGGATGCTGAGGTGGGA GGG (reversed) | Intronic | ||
| Too many off-targets to display for this crispr | |||||