ID: 987016184

View in Genome Browser
Species Human (GRCh38)
Location 5:13822356-13822378
Sequence CTCTGGATGCTGAGGTGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4639
Summary {0: 1, 1: 43, 2: 524, 3: 1353, 4: 2718}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987016184_987016193 0 Left 987016184 5:13822356-13822378 CCCTCCCACCTCAGCATCCAGAG 0: 1
1: 43
2: 524
3: 1353
4: 2718
Right 987016193 5:13822379-13822401 TAGATGGGACTATAGGCACATGG 0: 1
1: 14
2: 146
3: 540
4: 1414
987016184_987016191 -7 Left 987016184 5:13822356-13822378 CCCTCCCACCTCAGCATCCAGAG 0: 1
1: 43
2: 524
3: 1353
4: 2718
Right 987016191 5:13822372-13822394 TCCAGAGTAGATGGGACTATAGG 0: 7
1: 474
2: 13152
3: 134596
4: 261264
987016184_987016194 24 Left 987016184 5:13822356-13822378 CCCTCCCACCTCAGCATCCAGAG 0: 1
1: 43
2: 524
3: 1353
4: 2718
Right 987016194 5:13822403-13822425 ACCATGCCCAACTAATTTTTTGG 0: 5
1: 117
2: 340
3: 671
4: 899

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987016184 Original CRISPR CTCTGGATGCTGAGGTGGGA GGG (reversed) Intronic
Too many off-targets to display for this crispr