ID: 987016191

View in Genome Browser
Species Human (GRCh38)
Location 5:13822372-13822394
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 409493
Summary {0: 7, 1: 474, 2: 13152, 3: 134596, 4: 261264}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987016184_987016191 -7 Left 987016184 5:13822356-13822378 CCCTCCCACCTCAGCATCCAGAG 0: 1
1: 43
2: 524
3: 1353
4: 2718
Right 987016191 5:13822372-13822394 TCCAGAGTAGATGGGACTATAGG 0: 7
1: 474
2: 13152
3: 134596
4: 261264
987016180_987016191 17 Left 987016180 5:13822332-13822354 CCTCAGCCTCCCAGGCTTAAGTG 0: 3
1: 180
2: 3130
3: 25037
4: 71933
Right 987016191 5:13822372-13822394 TCCAGAGTAGATGGGACTATAGG 0: 7
1: 474
2: 13152
3: 134596
4: 261264
987016185_987016191 -8 Left 987016185 5:13822357-13822379 CCTCCCACCTCAGCATCCAGAGT 0: 11
1: 1166
2: 14195
3: 34392
4: 50283
Right 987016191 5:13822372-13822394 TCCAGAGTAGATGGGACTATAGG 0: 7
1: 474
2: 13152
3: 134596
4: 261264
987016183_987016191 7 Left 987016183 5:13822342-13822364 CCAGGCTTAAGTGACCCTCCCAC 0: 13
1: 294
2: 3853
3: 9967
4: 17306
Right 987016191 5:13822372-13822394 TCCAGAGTAGATGGGACTATAGG 0: 7
1: 474
2: 13152
3: 134596
4: 261264
987016181_987016191 11 Left 987016181 5:13822338-13822360 CCTCCCAGGCTTAAGTGACCCTC 0: 10
1: 235
2: 3295
3: 11051
4: 46083
Right 987016191 5:13822372-13822394 TCCAGAGTAGATGGGACTATAGG 0: 7
1: 474
2: 13152
3: 134596
4: 261264
987016182_987016191 8 Left 987016182 5:13822341-13822363 CCCAGGCTTAAGTGACCCTCCCA 0: 13
1: 311
2: 4781
3: 20130
4: 44548
Right 987016191 5:13822372-13822394 TCCAGAGTAGATGGGACTATAGG 0: 7
1: 474
2: 13152
3: 134596
4: 261264

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
Too many off-targets to display for this crispr