ID: 987016193

View in Genome Browser
Species Human (GRCh38)
Location 5:13822379-13822401
Sequence TAGATGGGACTATAGGCACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2115
Summary {0: 1, 1: 14, 2: 146, 3: 540, 4: 1414}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987016186_987016193 -4 Left 987016186 5:13822360-13822382 CCCACCTCAGCATCCAGAGTAGA 0: 1
1: 41
2: 2209
3: 35561
4: 243113
Right 987016193 5:13822379-13822401 TAGATGGGACTATAGGCACATGG 0: 1
1: 14
2: 146
3: 540
4: 1414
987016187_987016193 -5 Left 987016187 5:13822361-13822383 CCACCTCAGCATCCAGAGTAGAT 0: 1
1: 39
2: 2074
3: 25492
4: 48367
Right 987016193 5:13822379-13822401 TAGATGGGACTATAGGCACATGG 0: 1
1: 14
2: 146
3: 540
4: 1414
987016181_987016193 18 Left 987016181 5:13822338-13822360 CCTCCCAGGCTTAAGTGACCCTC 0: 10
1: 235
2: 3295
3: 11051
4: 46083
Right 987016193 5:13822379-13822401 TAGATGGGACTATAGGCACATGG 0: 1
1: 14
2: 146
3: 540
4: 1414
987016180_987016193 24 Left 987016180 5:13822332-13822354 CCTCAGCCTCCCAGGCTTAAGTG 0: 3
1: 180
2: 3130
3: 25037
4: 71933
Right 987016193 5:13822379-13822401 TAGATGGGACTATAGGCACATGG 0: 1
1: 14
2: 146
3: 540
4: 1414
987016184_987016193 0 Left 987016184 5:13822356-13822378 CCCTCCCACCTCAGCATCCAGAG 0: 1
1: 43
2: 524
3: 1353
4: 2718
Right 987016193 5:13822379-13822401 TAGATGGGACTATAGGCACATGG 0: 1
1: 14
2: 146
3: 540
4: 1414
987016185_987016193 -1 Left 987016185 5:13822357-13822379 CCTCCCACCTCAGCATCCAGAGT 0: 11
1: 1166
2: 14195
3: 34392
4: 50283
Right 987016193 5:13822379-13822401 TAGATGGGACTATAGGCACATGG 0: 1
1: 14
2: 146
3: 540
4: 1414
987016189_987016193 -8 Left 987016189 5:13822364-13822386 CCTCAGCATCCAGAGTAGATGGG 0: 2
1: 166
2: 11931
3: 223996
4: 280796
Right 987016193 5:13822379-13822401 TAGATGGGACTATAGGCACATGG 0: 1
1: 14
2: 146
3: 540
4: 1414
987016182_987016193 15 Left 987016182 5:13822341-13822363 CCCAGGCTTAAGTGACCCTCCCA 0: 13
1: 311
2: 4781
3: 20130
4: 44548
Right 987016193 5:13822379-13822401 TAGATGGGACTATAGGCACATGG 0: 1
1: 14
2: 146
3: 540
4: 1414
987016183_987016193 14 Left 987016183 5:13822342-13822364 CCAGGCTTAAGTGACCCTCCCAC 0: 13
1: 294
2: 3853
3: 9967
4: 17306
Right 987016193 5:13822379-13822401 TAGATGGGACTATAGGCACATGG 0: 1
1: 14
2: 146
3: 540
4: 1414

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987016193 Original CRISPR TAGATGGGACTATAGGCACA TGG Intronic
Too many off-targets to display for this crispr