ID: 987016194

View in Genome Browser
Species Human (GRCh38)
Location 5:13822403-13822425
Sequence ACCATGCCCAACTAATTTTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2032
Summary {0: 5, 1: 117, 2: 340, 3: 671, 4: 899}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987016192_987016194 7 Left 987016192 5:13822373-13822395 CCAGAGTAGATGGGACTATAGGC 0: 29
1: 5486
2: 92531
3: 216099
4: 241562
Right 987016194 5:13822403-13822425 ACCATGCCCAACTAATTTTTTGG 0: 5
1: 117
2: 340
3: 671
4: 899
987016184_987016194 24 Left 987016184 5:13822356-13822378 CCCTCCCACCTCAGCATCCAGAG 0: 1
1: 43
2: 524
3: 1353
4: 2718
Right 987016194 5:13822403-13822425 ACCATGCCCAACTAATTTTTTGG 0: 5
1: 117
2: 340
3: 671
4: 899
987016186_987016194 20 Left 987016186 5:13822360-13822382 CCCACCTCAGCATCCAGAGTAGA 0: 1
1: 41
2: 2209
3: 35561
4: 243113
Right 987016194 5:13822403-13822425 ACCATGCCCAACTAATTTTTTGG 0: 5
1: 117
2: 340
3: 671
4: 899
987016185_987016194 23 Left 987016185 5:13822357-13822379 CCTCCCACCTCAGCATCCAGAGT 0: 11
1: 1166
2: 14195
3: 34392
4: 50283
Right 987016194 5:13822403-13822425 ACCATGCCCAACTAATTTTTTGG 0: 5
1: 117
2: 340
3: 671
4: 899
987016187_987016194 19 Left 987016187 5:13822361-13822383 CCACCTCAGCATCCAGAGTAGAT 0: 1
1: 39
2: 2074
3: 25492
4: 48367
Right 987016194 5:13822403-13822425 ACCATGCCCAACTAATTTTTTGG 0: 5
1: 117
2: 340
3: 671
4: 899
987016189_987016194 16 Left 987016189 5:13822364-13822386 CCTCAGCATCCAGAGTAGATGGG 0: 2
1: 166
2: 11931
3: 223996
4: 280796
Right 987016194 5:13822403-13822425 ACCATGCCCAACTAATTTTTTGG 0: 5
1: 117
2: 340
3: 671
4: 899

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987016194 Original CRISPR ACCATGCCCAACTAATTTTT TGG Intronic
Too many off-targets to display for this crispr