ID: 987016429

View in Genome Browser
Species Human (GRCh38)
Location 5:13824811-13824833
Sequence CAGGATTACCTGAAGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 330
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 303}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987016429 Original CRISPR CAGGATTACCTGAAGGAGGA AGG Intronic
900410422 1:2510149-2510171 CAGGATGACCTGCAGGAGGAGGG + Exonic
901600445 1:10419526-10419548 CAGGCTTACCTGGATGAGGCTGG - Exonic
901684243 1:10934878-10934900 CAGGATTTGCTGAAGGCTGAGGG - Intergenic
902155622 1:14483283-14483305 CAGGGTTGCATGGAGGAGGAGGG - Intergenic
902839340 1:19065346-19065368 CAGGGTAACCGGGAGGAGGACGG + Intergenic
904887420 1:33751328-33751350 GAGGGTTTCCAGAAGGAGGAAGG + Intronic
905119797 1:35672861-35672883 CAGGATCATCAGAAGGAGGTGGG - Intergenic
907222084 1:52914506-52914528 CAGGATAAGCTGAGGCAGGAGGG + Intronic
907787286 1:57625240-57625262 CAGGAGTAGAAGAAGGAGGAGGG - Intronic
908107688 1:60862069-60862091 CATGATGACCTGAATGAGGCTGG + Intergenic
909303236 1:74039352-74039374 CTGGAGTACCTGAAGGAGATGGG + Intronic
910351786 1:86307051-86307073 CAGGAGTACTGGAAGGAGGCTGG - Intergenic
910943077 1:92558121-92558143 CAGGAGTCCCAGAAGGAGGAAGG - Intronic
915323501 1:155069034-155069056 CAAGATCCCCTGGAGGAGGAGGG + Exonic
915544162 1:156586455-156586477 CTGGATGACCTGAAAGAGGCAGG - Exonic
915547512 1:156609748-156609770 CAGGCCTACTTGAGGGAGGAGGG + Intergenic
915584773 1:156838491-156838513 CAGGTTGACCTGGAGAAGGAAGG - Intronic
915632550 1:157163491-157163513 CAGGATCACCTGCAGGGGGCAGG - Intergenic
917062702 1:171057491-171057513 CTGGAATACCTGAAGGAGATGGG + Intronic
917582171 1:176390330-176390352 CTGGAGTACCTGAAGGAGAAGGG - Intergenic
917595428 1:176524563-176524585 AAAGACTTCCTGAAGGAGGAAGG + Intronic
918344547 1:183595208-183595230 CAGGAAACCCTGAAGGAGGCAGG + Intronic
918558623 1:185836784-185836806 CAGGTCTACTTGAAGGTGGAGGG - Intronic
918955384 1:191200238-191200260 CTGGAGTACCTGAAGGAGATGGG + Intergenic
919031652 1:192250751-192250773 CTGGAGTACCTGAAGGAGACAGG - Intergenic
919817858 1:201452944-201452966 CAGGATGCCCTGAGGTAGGAAGG + Intergenic
919865801 1:201782162-201782184 CAGGTTTGCCTGCAAGAGGACGG - Exonic
919905928 1:202078297-202078319 CAGAATTCCCTGAATGAGGCAGG - Intergenic
920373088 1:205492013-205492035 CAGGTTTCCCTGAAAGGGGATGG - Intergenic
920387619 1:205579936-205579958 CGGGCTTACCTGGAGGAAGACGG - Exonic
920572940 1:207031659-207031681 CAGATTTACCTGCAGAAGGAAGG - Intronic
920776056 1:208938347-208938369 GAGGATGAGATGAAGGAGGAGGG - Intergenic
922451095 1:225737937-225737959 CAGGACCAGGTGAAGGAGGAAGG - Intergenic
922821188 1:228486999-228487021 CAGGAGTTACTGAAGTAGGAAGG + Intergenic
923357375 1:233172699-233172721 CAGGAGTACCTGGAGGAAGCAGG - Intronic
923788404 1:237090383-237090405 GAGGATTACATGAGGGAGGCAGG + Intronic
924567994 1:245213808-245213830 CAGAATTTCCTGATTGAGGATGG + Intronic
1063244799 10:4206739-4206761 CGGGATGAGCAGAAGGAGGATGG - Intergenic
1063399080 10:5723756-5723778 CAGAATTACTTGGAGGAGAAAGG + Exonic
1064033160 10:11895624-11895646 GAGGATTACTTGAGGGTGGAGGG - Intergenic
1064358316 10:14639843-14639865 CAGTGTTAGCTGAAGGAGGAAGG - Intronic
1065022857 10:21515383-21515405 CAGTTTTACCTGTAGGACGAGGG + Exonic
1067223670 10:44361819-44361841 CAGGCTTTCCTGGAGGAGAAGGG + Intergenic
1067723397 10:48747908-48747930 CAGAATGGCCTGAATGAGGATGG - Intronic
1068137487 10:52965219-52965241 CAGGACTACCAGCAGCAGGAGGG - Intergenic
1073054568 10:100690851-100690873 CAGGAGGATGTGAAGGAGGAAGG + Intergenic
1073667204 10:105546871-105546893 AAGGATTAGCTGAAGGTGAATGG - Intergenic
1074821038 10:117178643-117178665 CAGGAAGACCTGAAGCAGGAAGG - Intergenic
1075600190 10:123761910-123761932 GAGGACTTCCAGAAGGAGGAGGG - Exonic
1076056127 10:127374675-127374697 CTGGATTACCTGCAAGGGGAGGG + Intronic
1083096558 11:60256850-60256872 CAGGAGTATCTGAAGGAAGGAGG - Intergenic
1083556784 11:63635862-63635884 CACGACTACCTCAAGGCGGATGG - Intronic
1083949793 11:65947608-65947630 CAGGACTCCCTGCAGAAGGAGGG + Exonic
1086563216 11:88192891-88192913 GAGGCTTACCTGAGGGTGGAGGG - Intergenic
1087203721 11:95372322-95372344 CAGGAGGATGTGAAGGAGGAGGG + Intergenic
1089453475 11:118612390-118612412 CAGCATTTTCTGAGGGAGGAGGG - Intronic
1089516520 11:119035758-119035780 CAGGATTGCTTGAGGCAGGAAGG + Intergenic
1089668480 11:120035337-120035359 CAGGATTATCTGCAGAAGGAAGG - Intergenic
1090017317 11:123097749-123097771 CAGGAGGACAAGAAGGAGGAGGG + Intronic
1090109003 11:123884566-123884588 CAGGATTAAGTTAAGGAGGAAGG + Exonic
1090465960 11:126933387-126933409 CGTGATGACTTGAAGGAGGAAGG - Intronic
1090669661 11:128937435-128937457 CAGGATTCCGAGGAGGAGGAGGG + Intronic
1092044252 12:5417525-5417547 CAAGATTCACTGAAGGAGAAGGG - Intergenic
1092060654 12:5547812-5547834 CAGGATCACAGGAAGGATGAGGG + Intronic
1093843296 12:23933216-23933238 CAGGGTTAGCTGGAGCAGGATGG - Intronic
1094846227 12:34362572-34362594 CAGGAATGCTTGAAAGAGGAGGG - Intergenic
1094846913 12:34365387-34365409 CAGGAATGCTTGAAAGAGGAGGG - Intergenic
1095708533 12:45263653-45263675 CAGGATTACATGAAGAATGGGGG + Intronic
1095788027 12:46132024-46132046 CAGGAAAGCATGAAGGAGGAGGG + Intergenic
1096612194 12:52809513-52809535 CAGGAATGCCAGTAGGAGGACGG + Intronic
1096777411 12:53972803-53972825 CAGGATTGGGGGAAGGAGGAGGG - Intergenic
1097961289 12:65534140-65534162 CAGCACTACCTGAATGAGCAAGG - Intergenic
1099143370 12:79008202-79008224 CTGGAATATCTGAAGGAAGAGGG + Intronic
1099765560 12:86978654-86978676 CATGATTAACTGAAGGAAAATGG + Intergenic
1101785977 12:107884011-107884033 CAGGGATAACGGAAGGAGGAAGG - Intergenic
1101800048 12:108013826-108013848 CTGGAAGACCTGAAGGAGGAAGG - Intergenic
1104057280 12:125240113-125240135 CAGAATCACCAGAAGGTGGAAGG - Intronic
1104876537 12:132038838-132038860 CAGGGCCACATGAAGGAGGAGGG - Intronic
1106998144 13:35512254-35512276 GAGGATTACCTGATGGTTGAAGG + Intronic
1108300433 13:49068891-49068913 AGGGCTTACCTGAAGGTGGAGGG + Intronic
1108679922 13:52771209-52771231 GAGGACTACAAGAAGGAGGAGGG - Intergenic
1109048998 13:57453606-57453628 CAGGATGACCTGAAGAAATATGG - Intergenic
1111541000 13:89667199-89667221 CTGGAGTACCTGATGGAGAATGG - Intergenic
1112591814 13:100770351-100770373 CAGGACTCCCAGAAGGAAGAGGG - Intergenic
1113695047 13:112339379-112339401 AATGATTAGCTGAAGGAGGAAGG + Intergenic
1114871791 14:26667155-26667177 TAGGAAGACCAGAAGGAGGAAGG - Intergenic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1118510877 14:66471800-66471822 CAGGATAACTTGAAGCAGGGAGG - Intergenic
1118530838 14:66703172-66703194 CTGGAATACCTGAAGGAGATGGG + Intronic
1119021992 14:71124015-71124037 CAGGATCACCAGGAGGAGGCGGG - Intergenic
1119766791 14:77195571-77195593 CAGAATCATCTGCAGGAGGAGGG - Intronic
1120994587 14:90407093-90407115 CAGCATTCCCTGGAGGGGGAGGG - Exonic
1121148583 14:91608122-91608144 CAGGAATAGCTGTAAGAGGAGGG + Intronic
1121708902 14:96022256-96022278 CTGGTTTAACTGAAGGAGGTGGG - Intergenic
1121835545 14:97088867-97088889 GAGGATGACCTGGAGGAGGAAGG + Intergenic
1122274682 14:100585486-100585508 CAGGAGTGCCTGCAGGAGTAGGG + Intronic
1124047253 15:26161710-26161732 CAGCAGTACCAGCAGGAGGAAGG - Intergenic
1124953310 15:34343042-34343064 CAGTATTACCTCAACGAGCAGGG - Exonic
1125955665 15:43789345-43789367 TGGGATGACCTGAGGGAGGAGGG + Intronic
1127329286 15:57922974-57922996 CAGGATCAGCTCAGGGAGGAGGG + Intergenic
1127456208 15:59158278-59158300 CTGGCTTACCTGGGGGAGGAGGG + Exonic
1128283595 15:66417639-66417661 CAGGATTCCCTGAAGGTTGTTGG + Intronic
1128519132 15:68364166-68364188 CAGGATTAGATGAAGAAGGCTGG - Intronic
1128898574 15:71398356-71398378 GAGGGTGACCTGAAGAAGGAAGG + Intronic
1129000321 15:72327850-72327872 CAGGATTTCCTGAAGAGGAAAGG - Intronic
1131422945 15:92322383-92322405 CAGGCTCATCTGAATGAGGAAGG - Intergenic
1131585824 15:93691699-93691721 GAGGATTAACTGAGGGAGGAGGG + Intergenic
1133000532 16:2849160-2849182 CAGGACTAGAAGAAGGAGGAAGG + Intergenic
1134135491 16:11674027-11674049 CAGGTTTGCCTGAAGGACAAAGG - Intronic
1134755439 16:16663318-16663340 GAGGATTAACAGAAAGAGGAAGG + Intergenic
1134990627 16:18695852-18695874 GAGGATTAACAGAAAGAGGAAGG - Intergenic
1135661250 16:24298874-24298896 CATGATTACATGAAGGATCATGG + Intronic
1136014173 16:27384173-27384195 CAGAATTGGCTGAAAGAGGAAGG - Intergenic
1136480046 16:30535438-30535460 CAGGAAGACGTGAAGCAGGAAGG + Intronic
1137701667 16:50502213-50502235 CAGGCTGACCTGGAGGAGAAGGG + Intergenic
1138077711 16:54058646-54058668 CAGTTATACCTGCAGGAGGATGG - Intronic
1139001158 16:62511827-62511849 AAGGATTACCTGAAGCTGGGTGG + Intergenic
1139410302 16:66753260-66753282 GTGGATGACCTGAAGCAGGAAGG + Intergenic
1139531341 16:67544139-67544161 GAGGATTTCCAGAAGGAGGAAGG - Intronic
1141562647 16:84879769-84879791 CAGGATTATGGGAAGGAAGAAGG - Intronic
1142985197 17:3691090-3691112 CAGCGTTACCTGAAAGAGGGCGG + Intronic
1144200286 17:12934868-12934890 CAGGAGTACCACAAGGAGGCTGG + Intronic
1144677884 17:17173469-17173491 CTGGTTCACCTGCAGGAGGACGG + Intronic
1144678465 17:17176837-17176859 CAGGAGTCCCTGGAGGAGGCTGG - Intronic
1144754664 17:17671810-17671832 CAGGACAACCTGAAGAAGGTGGG + Intergenic
1146464621 17:33076353-33076375 CAGGCTCACATAAAGGAGGAGGG - Intronic
1148951595 17:51318137-51318159 CAGGATAACTTGAAGCAGGGAGG - Intergenic
1150651456 17:67012995-67013017 CAGGATTCCCTTAATGACGATGG + Intronic
1150783857 17:68146819-68146841 CAGCATTACCTCAGGGATGAGGG + Intergenic
1150915207 17:69429787-69429809 CAGGATAATCTGATGGATGATGG - Intronic
1151160781 17:72163702-72163724 CAGGATAAGCTGAAGGTGGGTGG - Intergenic
1151943520 17:77306975-77306997 CAGGGTTACCTGGGGGAGTAGGG + Intronic
1152181583 17:78825525-78825547 CAGGATTGCTGGAAAGAGGAGGG - Intronic
1156012765 18:32513259-32513281 CAGGAATACCTGGAGGTGCAGGG - Intergenic
1156291015 18:35748514-35748536 CAGGAAGACCTGCAGGATGATGG + Intergenic
1158996287 18:62923494-62923516 CAGGATTATGTGAAGGGGGTGGG + Intronic
1159959940 18:74547522-74547544 CAGGCATCCCTAAAGGAGGATGG - Intronic
1160342627 18:78102490-78102512 CAGGATGACCTGAAGGCGGGGGG + Intergenic
1160787096 19:905723-905745 CAGGGCTGCCTGAAGCAGGAAGG + Intronic
1163142825 19:15362036-15362058 CCGGATCCCTTGAAGGAGGAAGG - Intronic
1163510885 19:17734259-17734281 CAGGGTCACCTGCAGGTGGAGGG - Exonic
1163584514 19:18156539-18156561 CAGGAGGACCAGAGGGAGGAAGG + Intronic
1164913798 19:32033605-32033627 TAGGATTGCCTGAAGGTAGAGGG - Intergenic
1165100174 19:33434577-33434599 CAGGATTCCCCGCAGGACGAGGG + Intronic
1166547552 19:43642376-43642398 CAGGGTACCCTGAAGTAGGATGG - Intergenic
1167409487 19:49336663-49336685 GAGGAGGAGCTGAAGGAGGAAGG + Intronic
1167446213 19:49539105-49539127 CAGGGTTTCCTGGAGGAGAAAGG - Exonic
1168140263 19:54381208-54381230 CAAGAAGACCTGAAGGAGAAGGG - Intergenic
1168316382 19:55486529-55486551 CAGGAACACCGGCAGGAGGAGGG - Exonic
924985266 2:264485-264507 GAGGGGTACCTGGAGGAGGAAGG - Intronic
925585725 2:5462097-5462119 CAGGATGAGCTGAAGGTGGGAGG + Intergenic
925674532 2:6346954-6346976 CTGAATTACCTGGAGGTGGAAGG + Intergenic
928194752 2:29207139-29207161 CAGGGATACCTGGAGGATGATGG + Intronic
928703396 2:33922109-33922131 CAGGATAACCTAAAGGAAGTAGG - Intergenic
929793973 2:45044332-45044354 AAGAATTACCAGAAGGAGAATGG - Intergenic
932402223 2:71488958-71488980 GAGGAGCAGCTGAAGGAGGAAGG - Intronic
932749934 2:74365099-74365121 TAGCAATGCCTGAAGGAGGAGGG + Exonic
933002286 2:76940475-76940497 CAGGTCTACCTGAGGGTGGAGGG + Intronic
936889283 2:117350287-117350309 CAGAATTGCCTCAAGGAAGATGG + Intergenic
937336783 2:121067153-121067175 CAGGAGACCCTGAAGGAGAAGGG + Intergenic
937554425 2:123135429-123135451 CAGGATTACTTGAGGGTGTAGGG - Intergenic
939671598 2:145019237-145019259 CATGATTATTTGAAAGAGGAAGG - Intergenic
940238287 2:151534484-151534506 GAAGATTACCTGAAGAAGGCTGG + Intronic
940285721 2:152031525-152031547 CAGCACAACCTGAGGGAGGAAGG + Intronic
940396920 2:153200180-153200202 GAGGATAAACTGAAGCAGGAAGG + Intergenic
941425084 2:165333203-165333225 TACCATTACCAGAAGGAGGATGG + Intronic
942964592 2:181876324-181876346 GAGGATTAGTGGAAGGAGGAAGG - Intergenic
943228292 2:185209738-185209760 CCTGATTATCAGAAGGAGGAAGG + Intergenic
943564605 2:189503074-189503096 CAGGTCTCCCTGAAGGAAGAGGG - Intergenic
943928472 2:193819486-193819508 CAGGACTACCAGTAGCAGGATGG - Intergenic
944495595 2:200305115-200305137 GAGGATTACCTGAACCAGGTAGG - Intergenic
948277965 2:236724649-236724671 GAGGAATATCTGAAGGAAGATGG - Intergenic
948403457 2:237701109-237701131 CAGGATCCCCTGAAGGAGTGTGG + Intronic
1169026077 20:2372540-2372562 ATGGATTACCTGCAGGAGGCAGG - Intergenic
1169366717 20:4998513-4998535 CAGCTTAACCTGGAGGAGGATGG + Intronic
1169394091 20:5214499-5214521 CAGGATTTCCAGAAGGTGCATGG + Intergenic
1169527573 20:6446810-6446832 TAGGGTTACCTGATTGAGGAGGG - Intergenic
1170764079 20:19275293-19275315 CAGCATTCCCTGCAAGAGGATGG + Intronic
1173013240 20:39201300-39201322 CAGAAATGCCTGATGGAGGAAGG - Intergenic
1173372173 20:42446861-42446883 CAGGATTACCAGATGGAAGGAGG - Intronic
1173464964 20:43273553-43273575 CATGGTTACCTGAAGGAGGGTGG - Intergenic
1174286271 20:49475936-49475958 CAGGGTTGTCTGAAGGATGAAGG - Intronic
1175913964 20:62417104-62417126 CAGGATAAACTGAACCAGGAAGG - Intronic
1176197632 20:63844682-63844704 CAGGTTTTCCTGAGGAAGGAAGG + Intergenic
1178172152 21:30053416-30053438 CATGACCACCTGGAGGAGGAAGG - Intergenic
1179229380 21:39487841-39487863 CCTGGTGACCTGAAGGAGGAAGG + Intronic
1181408738 22:22703343-22703365 CAGCATCTCCTGAAGGAGGCTGG - Intergenic
1182134556 22:27889161-27889183 CCTGATAACCTGAGGGAGGAGGG + Intronic
1183069780 22:35387903-35387925 CTGGATTTTCTGAAGGGGGAGGG - Intronic
1183733621 22:39631542-39631564 GAGGACTGCCTGGAGGAGGAGGG + Intronic
950919874 3:16683661-16683683 CGGGAAAACCTGAAGTAGGAAGG - Intergenic
953722394 3:45367967-45367989 CAGGATTAGCTGAAACAAGAAGG + Intergenic
955251516 3:57287612-57287634 CAGAATTACCTCATGGAGCAGGG - Intronic
955458235 3:59149339-59149361 CAGGAGACCCAGAAGGAGGATGG - Intergenic
955927628 3:64023391-64023413 CTGGAGAACCTGGAGGAGGAGGG - Exonic
956017551 3:64899867-64899889 CATGATTGCCTGAAGGAAAAGGG - Intergenic
956239415 3:67112845-67112867 AAGGATTATCTGCAGGAGCATGG + Intergenic
957816413 3:85304254-85304276 CTTGATTACATGAAGGAGTACGG - Intronic
958451843 3:94282681-94282703 AAGGATGCCCTGAAAGAGGAAGG - Intergenic
958686974 3:97411127-97411149 CAGCATTACCTGAAAGAAAATGG + Intronic
959348380 3:105228807-105228829 CAGGAATACATGAAGGAAGTGGG - Intergenic
960252497 3:115471536-115471558 TAGGATGACATGTAGGAGGAGGG + Intergenic
964292068 3:155192609-155192631 CAGGATTCCCAGAAGAGGGAAGG - Intergenic
967081663 3:186055168-186055190 CAGGTTTACCTGCAGCTGGACGG + Intronic
967702209 3:192606359-192606381 GAGGACTACCAGAAAGAGGAGGG + Intronic
970148533 4:13065003-13065025 CAGGAGTACCTGAAAGAGAAGGG - Intergenic
970185208 4:13444995-13445017 TAGGATTACCTGAAAGAGATGGG - Intronic
970723372 4:19014183-19014205 CAAGTTTACCTGGGGGAGGAAGG + Intergenic
972721716 4:41706217-41706239 CAGGATTTGGTGCAGGAGGAAGG + Intergenic
972765154 4:42146097-42146119 CAGGATTGGCTGGAGAAGGAGGG - Intronic
974666332 4:64967471-64967493 CAGGATTTACTGCTGGAGGAAGG + Intergenic
975205253 4:71638202-71638224 CAGGAAGACCTGAAGTGGGAAGG - Intergenic
976602189 4:86948239-86948261 CAAGTTTACCATAAGGAGGAGGG - Intronic
978197925 4:105991972-105991994 CAGGAGGACATGAAGAAGGATGG - Intronic
980303444 4:131024722-131024744 CAGAAATACCTGAAGTAGTAAGG - Intergenic
981051252 4:140311597-140311619 CAGGCTTACCAGGAGGAAGAGGG - Intronic
982004283 4:151049423-151049445 CAGGATGGCCTGCCGGAGGATGG + Intergenic
982499889 4:156140480-156140502 GAGGATTACTTGAAAGTGGAGGG + Intergenic
982505608 4:156213602-156213624 CAGGAAGACTTGAAGCAGGAGGG + Intergenic
983518039 4:168677811-168677833 CAGGATTAACTGGCGGAGTAGGG - Intronic
984092258 4:175388578-175388600 CTGGAGTACCTGAAGGAGACAGG + Intergenic
984944878 4:184963025-184963047 CAGGGAAAACTGAAGGAGGATGG - Intergenic
985355789 4:189117191-189117213 CAGCATCAGCTGAAGTAGGAGGG - Intergenic
985470683 5:42504-42526 CAGGATTACCTGGGAGAGGGTGG + Intergenic
986113218 5:4741387-4741409 GAGGACTACCAGATGGAGGAGGG + Intergenic
986784909 5:11105247-11105269 CAGGATTATCTGAAGGAGGTTGG - Intronic
987016429 5:13824811-13824833 CAGGATTACCTGAAGGAGGAAGG + Intronic
987025910 5:13926188-13926210 AAGGAGCACCTGAGGGAGGATGG + Intronic
987270592 5:16304484-16304506 CAGGAATACCAGAATGAGCAAGG + Intergenic
987444636 5:18002460-18002482 CTGGATAGCCTGAAGGAGGAAGG + Intergenic
987562659 5:19543672-19543694 CAGAATTACAGTAAGGAGGAAGG + Intronic
987988426 5:25180070-25180092 TTGGATTATCTGAAGGAGGCAGG - Intergenic
988294074 5:29331951-29331973 CAGGAAAAGCTGGAGGAGGATGG + Intergenic
988624512 5:32858730-32858752 GAGGACTACTAGAAGGAGGAAGG - Intergenic
988856738 5:35234405-35234427 CAGGATTAGATGAAGGAAGGAGG - Intergenic
989404740 5:41047712-41047734 CAGCCTTACCTGAAGCAGCATGG + Exonic
989682459 5:44045692-44045714 CTGGAGTACCTGAAGGAGACAGG - Intergenic
990363963 5:55050308-55050330 CAGGATTACTAGAAGAAGGGAGG - Intergenic
990888826 5:60625699-60625721 TTGGAATCCCTGAAGGAGGAGGG - Intronic
992136636 5:73752702-73752724 CAGGAGTAACTGAAAGAAGATGG + Intronic
993959167 5:94275738-94275760 AAGGACTACCTGAGGGAGCAAGG - Intronic
994776268 5:104038715-104038737 CAGGACAACTTGAAGCAGGAAGG - Intergenic
995943053 5:117608163-117608185 CAGGATCACGTGAAGCAGCAGGG - Intergenic
996965701 5:129305325-129305347 TTGGAGTACCTGAAGGAGGCGGG - Intergenic
998092553 5:139379826-139379848 CAGCATGATCTGAAGGAGGGGGG + Exonic
999481135 5:151949175-151949197 CAAGACTTCCTGAAGGAGGAAGG + Intergenic
999686939 5:154111570-154111592 GAGGATTACCTGAGGCTGGAAGG + Intronic
1001185413 5:169567001-169567023 CAGGAATAGGTGAAGGTGGAAGG - Intergenic
1003248909 6:4407168-4407190 CTGGAGTACCTGAAGGAGATGGG + Intergenic
1003666089 6:8112617-8112639 CAGGATGAATTGGAGGAGGAAGG - Intergenic
1004253639 6:14043203-14043225 CAGGAGTCCCTGCATGAGGATGG + Intergenic
1007170608 6:39860642-39860664 CAGGGTGACCTGAAGCAGGAGGG + Intronic
1007509071 6:42361771-42361793 CAGAGCTGCCTGAAGGAGGATGG - Intronic
1007829056 6:44624490-44624512 AATGAGAACCTGAAGGAGGAGGG + Intergenic
1008114768 6:47535657-47535679 CATTATTGCCTGAAGGTGGATGG + Intronic
1009902534 6:69825839-69825861 CAGCTTTACCTCAAGGAGGATGG + Intergenic
1012258378 6:97060381-97060403 GAGGATGAGCTGAAGAAGGAGGG + Intronic
1012469355 6:99553594-99553616 GAAGATTTACTGAAGGAGGAAGG - Intronic
1013933264 6:115561802-115561824 CAAAATTATCTGAAGGCGGATGG - Intergenic
1014274170 6:119368101-119368123 CAGGACTACTAGAAGCAGGAGGG + Intergenic
1018410573 6:163542241-163542263 GAGGATTAACGGAAGGAGGAAGG - Intronic
1019494609 7:1331978-1332000 CAGGACATTCTGAAGGAGGAGGG + Intergenic
1019597340 7:1864246-1864268 CCTGAACACCTGAAGGAGGAGGG + Intronic
1019688842 7:2398387-2398409 GGGGATCAGCTGAAGGAGGAAGG - Intergenic
1019951234 7:4374551-4374573 GAGGATGACCTTGAGGAGGAAGG - Intergenic
1020646420 7:10819710-10819732 GAGGAATAGCTGAAGTAGGAAGG + Intergenic
1020659588 7:10966299-10966321 CAGGACTACCTGCCTGAGGATGG - Intergenic
1023677435 7:42645016-42645038 AAGGACTACCAGAAGGAAGAGGG + Intergenic
1024531121 7:50393422-50393444 CAGGATGACATGAAGGGGGAAGG + Intronic
1024657087 7:51459996-51460018 CAGGATTCCCAGAAAGAGCAAGG + Intergenic
1026398309 7:69982441-69982463 CAGGATAGCCTGGAGCAGGAGGG - Intronic
1026400955 7:70012235-70012257 CAGGATTGGCTGGAGGAGGCAGG + Intronic
1027229600 7:76264555-76264577 CAGGACTTCCAGGAGGAGGAAGG + Intronic
1028078779 7:86548247-86548269 GAGGATGAGCTGAAGCAGGATGG - Intergenic
1029893603 7:103958108-103958130 AAGGATTAACTAAAGCAGGATGG + Intronic
1031634996 7:124091795-124091817 CAGGATAATCTGAAGGTGGGAGG - Intergenic
1032503288 7:132416198-132416220 CAGGATAACCAGCTGGAGGAAGG + Intronic
1033292573 7:140100052-140100074 CAGGGCTACCTGAGGGTGGATGG - Intronic
1033357904 7:140615625-140615647 CAGGATTGCTTGAACCAGGAAGG - Intronic
1036037045 8:5031060-5031082 CAGGAAGACCTGAAGGAGAGGGG - Intergenic
1036257813 8:7219522-7219544 TAGCATGACCTGAAGGATGATGG - Intergenic
1036259062 8:7226519-7226541 TAGCATGACCTGAAGGATGATGG - Intergenic
1036309861 8:7678118-7678140 TAGCATGACCTGAAGGATGATGG - Intergenic
1036311115 8:7685115-7685137 TAGCATGACCTGAAGGATGATGG - Intergenic
1036358411 8:8060993-8061015 TAGCATGACCTGAAGGATGATGG + Intergenic
1036390319 8:8318956-8318978 CTGGAGCACCTGAAGGAGCACGG - Exonic
1036476179 8:9095608-9095630 GAGGATCACCTGAAGCAGGGAGG - Intronic
1036615794 8:10386387-10386409 CAGATATACCTGAAGCAGGAGGG + Intronic
1036744064 8:11391512-11391534 AAGGAGTTCCAGAAGGAGGACGG - Intronic
1036892543 8:12605959-12605981 TAGCATGACCTGAAGGATGATGG - Intergenic
1037591214 8:20313535-20313557 CAGGAGAACCTCAAAGAGGAAGG - Intergenic
1037813279 8:22098934-22098956 CTGGGTAACCTGAAGGAAGAGGG - Exonic
1038035444 8:23682785-23682807 CAGGATGTCCTGGATGAGGAAGG + Exonic
1038083434 8:24166041-24166063 CAGTTTTTCCTGAAGGTGGAGGG + Intergenic
1038696868 8:29813952-29813974 TAGGATTACCTGAAGGATGGTGG + Intergenic
1040748554 8:50676248-50676270 CTGGAGTACCTGAAGGAGACAGG - Intronic
1041307720 8:56480005-56480027 CACAAGTAACTGAAGGAGGATGG - Intergenic
1041957108 8:63568450-63568472 CAGGAATTTCTGAAGGAAGATGG - Intergenic
1042094473 8:65198265-65198287 CAGCATTATCAGAAGGAGAAAGG - Intergenic
1043266802 8:78276961-78276983 CAGTAATACCTGAAGGTGGCTGG - Intergenic
1046652373 8:116851235-116851257 AAGAATTACCAGAAGGAGGGTGG + Intronic
1048384791 8:133902017-133902039 CAGGATTCCCTGAAAGATAAGGG + Intergenic
1049199707 8:141334087-141334109 AAGGACTTCCTGGAGGAGGAGGG + Intergenic
1050900956 9:10948035-10948057 CATGATTACCTCCAGGAGAAAGG + Intergenic
1050932886 9:11351857-11351879 AATGATTACCTGTGGGAGGACGG + Intergenic
1051391955 9:16574786-16574808 GAGGATTACATGAAAGAGTAGGG - Intronic
1051882518 9:21854428-21854450 CAGGATTATGTGAATGAGAAAGG + Intronic
1056337226 9:85584377-85584399 AAGGAATACATGAAAGAGGAAGG - Intronic
1056417386 9:86390112-86390134 GAGGATTAGCTGAAGCAGGGTGG + Intergenic
1056705368 9:88948057-88948079 CAGAATTAAGTGAAGGAGGTAGG + Intergenic
1057531580 9:95851815-95851837 CATGATTACCTTTAGGCGGAAGG + Intergenic
1060279223 9:122204772-122204794 AAGGATGACCTGCAAGAGGAGGG + Exonic
1061201109 9:129139022-129139044 CAGGATAAGCTGGAGGAGCAGGG + Intronic
1061913148 9:133735366-133735388 GAGGGTTTCCTGAAGGAGGAGGG - Intronic
1188092323 X:25978288-25978310 CTGGAATACCTGAAGGAGACAGG + Intergenic
1191123485 X:56929897-56929919 GAGGTTTACTTGAATGAGGAAGG - Intergenic
1191704135 X:64075740-64075762 CAGGATTGCTTGAACCAGGAAGG + Intergenic
1194112123 X:89847537-89847559 GAGGCCTACCTGAAGGTGGAGGG + Intergenic
1194884878 X:99301715-99301737 CAGGGTTATGTGATGGAGGATGG + Intergenic
1195728615 X:107942385-107942407 GGGGACTACCTGAAGGAGAAGGG + Intergenic
1196758669 X:119180087-119180109 CAGAATCACCTGGAGGAGGAGGG - Intergenic
1196758948 X:119182359-119182381 CAGAATCACCTGGAGGAGGAGGG - Intergenic
1196811952 X:119635949-119635971 CAGGATGGAGTGAAGGAGGAGGG + Intronic
1197425311 X:126289755-126289777 AAGTAGTTCCTGAAGGAGGAAGG + Intergenic
1199736145 X:150688482-150688504 TAGGATTGCATGATGGAGGATGG - Intergenic
1200464778 Y:3502317-3502339 GAGGCCTACCTGAAGGTGGAGGG + Intergenic
1201453283 Y:14140168-14140190 AAGGCTTTCCTGAAGAAGGATGG + Intergenic
1201765585 Y:17571058-17571080 CAGGATTAACTGAATGAGTGTGG - Intergenic
1201835967 Y:18334931-18334953 CAGGATTAACTGAATGAGTGTGG + Intergenic
1201947330 Y:19526170-19526192 CAGGAATACCTGAGGAGGGAAGG + Intergenic