ID: 987017683

View in Genome Browser
Species Human (GRCh38)
Location 5:13836970-13836992
Sequence AGGGCTGTTCCAGCCTCTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 255
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 233}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987017683_987017688 -1 Left 987017683 5:13836970-13836992 CCTTCAGAGGCTGGAACAGCCCT 0: 1
1: 0
2: 1
3: 20
4: 233
Right 987017688 5:13836992-13837014 TGAGCTGACCTAAGACAATGGGG 0: 1
1: 0
2: 0
3: 10
4: 142
987017683_987017686 -3 Left 987017683 5:13836970-13836992 CCTTCAGAGGCTGGAACAGCCCT 0: 1
1: 0
2: 1
3: 20
4: 233
Right 987017686 5:13836990-13837012 CCTGAGCTGACCTAAGACAATGG 0: 1
1: 0
2: 2
3: 12
4: 133
987017683_987017692 19 Left 987017683 5:13836970-13836992 CCTTCAGAGGCTGGAACAGCCCT 0: 1
1: 0
2: 1
3: 20
4: 233
Right 987017692 5:13837012-13837034 GGGACCTGGGTCCTTCAACCAGG 0: 1
1: 0
2: 0
3: 4
4: 157
987017683_987017693 22 Left 987017683 5:13836970-13836992 CCTTCAGAGGCTGGAACAGCCCT 0: 1
1: 0
2: 1
3: 20
4: 233
Right 987017693 5:13837015-13837037 ACCTGGGTCCTTCAACCAGGAGG 0: 1
1: 0
2: 1
3: 6
4: 113
987017683_987017690 6 Left 987017683 5:13836970-13836992 CCTTCAGAGGCTGGAACAGCCCT 0: 1
1: 0
2: 1
3: 20
4: 233
Right 987017690 5:13836999-13837021 ACCTAAGACAATGGGGACCTGGG 0: 1
1: 0
2: 0
3: 8
4: 120
987017683_987017689 5 Left 987017683 5:13836970-13836992 CCTTCAGAGGCTGGAACAGCCCT 0: 1
1: 0
2: 1
3: 20
4: 233
Right 987017689 5:13836998-13837020 GACCTAAGACAATGGGGACCTGG No data
987017683_987017687 -2 Left 987017683 5:13836970-13836992 CCTTCAGAGGCTGGAACAGCCCT 0: 1
1: 0
2: 1
3: 20
4: 233
Right 987017687 5:13836991-13837013 CTGAGCTGACCTAAGACAATGGG 0: 1
1: 0
2: 0
3: 9
4: 110
987017683_987017695 27 Left 987017683 5:13836970-13836992 CCTTCAGAGGCTGGAACAGCCCT 0: 1
1: 0
2: 1
3: 20
4: 233
Right 987017695 5:13837020-13837042 GGTCCTTCAACCAGGAGGAAAGG 0: 1
1: 0
2: 0
3: 11
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987017683 Original CRISPR AGGGCTGTTCCAGCCTCTGA AGG (reversed) Intronic
900358324 1:2275365-2275387 GGGGCTGCCCCAGCCTCTGGGGG + Intronic
900572474 1:3365342-3365364 GGGGCTGTCCCTGCCCCTGAGGG + Intronic
902857416 1:19218755-19218777 AGGACTGATCCAGCCTCTCATGG - Exonic
903761594 1:25702397-25702419 TGGGCTCTCCCAGGCTCTGAGGG + Intronic
904163508 1:28538000-28538022 AGAGCTGATGAAGCCTCTGAGGG + Exonic
907437678 1:54459871-54459893 AGGTCTGTCCCAGCCCCTGGGGG + Intergenic
909042789 1:70674053-70674075 AGGGCTTTTTAAGGCTCTGAGGG + Intergenic
910746607 1:90581582-90581604 AGGGTTGTTCCTGCCTATGATGG - Intergenic
915813749 1:158944953-158944975 AGGGTTGTGCTGGCCTCTGAAGG - Exonic
916240145 1:162631587-162631609 AGGAATGATCCAGGCTCTGAAGG + Intronic
916743105 1:167663294-167663316 AGGGCTGTGCCTGCCCCTGCAGG - Intronic
918050676 1:180969985-180970007 AGGGTTGTTTCAGCAGCTGATGG - Intergenic
918708307 1:187696203-187696225 TGGGCTGCTGCAGCCTCTGCAGG + Intergenic
920560753 1:206936770-206936792 AGGGCTGTGGCAGGCTCTGCAGG - Intronic
921603591 1:217133247-217133269 AGGGCTTTTCCCGCCTTTGACGG - Intronic
922566901 1:226606956-226606978 CCTGCTGTTCCAGCCTCTGCAGG + Exonic
1063583008 10:7326343-7326365 GGGGCTCTTCCAGGCGCTGAGGG + Intronic
1065861211 10:29873675-29873697 AGGGTTTATCCAGCCTCTCAGGG + Intergenic
1067917101 10:50411853-50411875 GGTGGTGTTCCAGACTCTGATGG - Intronic
1068130582 10:52890261-52890283 AGGGCTGTGACAGCCTCTTTGGG + Intergenic
1068734012 10:60391699-60391721 AGTGCTTTGCCAGCCTCAGACGG - Intronic
1070061155 10:72984256-72984278 AGGGCTGTTCAGGTCTCTGCAGG - Intergenic
1070289412 10:75104862-75104884 AGAGCAGTTCCTGTCTCTGAAGG - Intronic
1071256775 10:83878523-83878545 AAGGTTGTTCCTGCCTCTGCAGG + Intergenic
1071819265 10:89264042-89264064 AGGGCTGTGCCACCCTCTTTGGG - Intronic
1072237478 10:93465920-93465942 AGGGCGGTCCCAGCCTCACAGGG - Intronic
1075411854 10:122234087-122234109 ATGGCTCTCCCAGCCTCGGATGG + Intronic
1076111171 10:127860880-127860902 CGGGCTGGACCAGGCTCTGAGGG - Intergenic
1076516324 10:131046761-131046783 AGGGATGATCCAGCCTCAGGGGG - Intergenic
1076828964 10:132984883-132984905 AGTGCTGTTCCAGGTGCTGAAGG + Intergenic
1077840053 11:5964564-5964586 AATGCTGTGCCAGCCTCAGAAGG - Intergenic
1078420759 11:11210235-11210257 AGGACTGTTCCTGCCTGTGCTGG - Intergenic
1078508120 11:11966919-11966941 AGGGTTTTTCCTGCATCTGAGGG + Intronic
1079317588 11:19422291-19422313 TGGGCTGATCCAGCTGCTGATGG + Intronic
1079361396 11:19773315-19773337 AAGGCAGATCCAGACTCTGAGGG + Intronic
1081085034 11:38788675-38788697 ATGACTGCTCCAGCTTCTGAAGG - Intergenic
1081757277 11:45553862-45553884 TGAGCTGTTCCAGCCACGGAGGG - Intergenic
1083189581 11:61040334-61040356 GGGCCTGTCCCAGCCTCTGAGGG + Intergenic
1084404589 11:68963875-68963897 AGGCCGGCTCCAGCCTGTGAGGG - Intergenic
1085198203 11:74684717-74684739 AGGGGTCTTCCTGCCTCTGATGG - Intergenic
1088693016 11:112343984-112344006 AGGCCTGCTGCAGCCTCTGAAGG + Intergenic
1089588490 11:119524846-119524868 AGGAATGGTCCAGCCTCTGAAGG + Intergenic
1091209211 11:133842291-133842313 AGGGCTTTGCCAGCCTCCCATGG - Intronic
1091665468 12:2415664-2415686 AGGGCTGTAACTGCCACTGACGG - Intronic
1092007641 12:5083100-5083122 AGGGCTTTTCCACCCTCCCATGG - Intergenic
1095569617 12:43669534-43669556 CTGCCTTTTCCAGCCTCTGATGG - Intergenic
1097157973 12:57026583-57026605 TGGGTTGTTTCAGCCTCTGAGGG - Intronic
1097293623 12:57941371-57941393 CGGGTTGTTACAGCCTTTGAGGG + Intergenic
1102287987 12:111674913-111674935 AGGGCTCTACCAGCCACTGGTGG - Intronic
1102766325 12:115436703-115436725 AGGGCTGTTCAATCCACAGAGGG + Intergenic
1103320699 12:120091247-120091269 ATGGCTGTTCCATCCACTGAGGG + Intronic
1103517327 12:121515787-121515809 TGGGCTCTGCCTGCCTCTGATGG + Intronic
1104764253 12:131316152-131316174 GGGGCTGTTCCAGGCACTGGGGG + Intergenic
1104845719 12:131845841-131845863 AGGGCTGCTCCTGCCTCGCACGG - Intronic
1105585118 13:21736591-21736613 AGGGCAGTGCCCGCCACTGAGGG + Intergenic
1106545523 13:30727660-30727682 ACAGCTGTTCCAGCTTCTGCTGG + Intronic
1107718488 13:43223943-43223965 AGGGCTGTAGCAGCCTATGGGGG - Intronic
1107789962 13:43991894-43991916 AGTGCTGTTACAGGCACTGAAGG + Intergenic
1108675042 13:52729284-52729306 AGGACTGTCCCAGGCTCTGCAGG - Intronic
1113485968 13:110652586-110652608 AGACCTGCTCCATCCTCTGAAGG - Intronic
1113869481 13:113549519-113549541 AGAGACGGTCCAGCCTCTGATGG + Exonic
1114364365 14:22011335-22011357 AGTGCTGTTCCAACCCCAGATGG + Intergenic
1114620889 14:24095354-24095376 GGGTCTGTTCCTGCCTCAGAGGG - Intronic
1118778356 14:68988731-68988753 GTGGCTGGTCCAGCCTCTCAGGG + Intergenic
1121295393 14:92816836-92816858 AGGGCTGTTGCAGCCCGTGCTGG + Intronic
1122858490 14:104571613-104571635 GGGGCTGCTGCAGCCTCTGCTGG - Intronic
1122877640 14:104676290-104676312 AGGGCTGTGGAGGCCTCTGAAGG - Intergenic
1123105531 14:105839526-105839548 AGGGCTGTCCCAGGCTCTTTTGG - Intergenic
1123491252 15:20784171-20784193 AGGGCTGGTCCGGTCTCAGACGG - Intergenic
1123547754 15:21353262-21353284 AGGGCTGGTCCGGTCTCAGACGG - Intergenic
1124430614 15:29604851-29604873 AGGGCTCTTCCACCCTTTGGGGG - Intergenic
1125330292 15:38575366-38575388 AGTGCTGCTCCTGCTTCTGATGG + Intergenic
1127343527 15:58070003-58070025 GGGGCTGTTTCAGCCTCAGGTGG + Intronic
1127833273 15:62769478-62769500 AGGGCTGTTCCCGGCCCTTAGGG - Intronic
1128601657 15:69000178-69000200 AGGGCTCTTCCACCCTTTTATGG + Intronic
1130624207 15:85496777-85496799 AGGTCTGCTCCAGCATCTGTGGG + Intronic
1132255783 15:100374251-100374273 GGGGCTAGTCCAGCCTCTGCAGG - Intergenic
1202956084 15_KI270727v1_random:80492-80514 AGGGCTGGTCCGGTCTCAGACGG - Intergenic
1134086551 16:11361427-11361449 AGGGCTCTGCCTGCGTCTGAGGG + Intronic
1138545331 16:57715798-57715820 AGGACTGTAGCATCCTCTGAAGG - Intronic
1139138612 16:64234133-64234155 AGGGCTGTGCCACCCTCTTTGGG + Intergenic
1139338307 16:66249259-66249281 AAGTCTGTTCTAGCATCTGAAGG - Intergenic
1139517057 16:67458375-67458397 AGCCCTGGCCCAGCCTCTGAGGG + Intronic
1139964123 16:70736126-70736148 GGGGCCGTTCCAGCCTCACAGGG + Intronic
1140213683 16:72990481-72990503 AGGCCTGTCCCAGCCACGGATGG + Intronic
1142750831 17:1986615-1986637 AAGGCTCTTCCAGCTTCTGGGGG - Intronic
1144581631 17:16462524-16462546 AGGCCTGCCCCAGCCCCTGAGGG - Intronic
1146296442 17:31654069-31654091 ATGGCTGTGCCAGCCTCTTCAGG - Intergenic
1148766920 17:50044946-50044968 AGGTCTGTTTCTCCCTCTGATGG - Intergenic
1149538056 17:57447672-57447694 GGGGATGATCCATCCTCTGAGGG - Intronic
1150216655 17:63475250-63475272 GGGGCTCTGTCAGCCTCTGAAGG - Intergenic
1150447883 17:65241710-65241732 TTGCCTCTTCCAGCCTCTGATGG - Intergenic
1150641627 17:66953434-66953456 AGGCCTGCTGGAGCCTCTGATGG - Intergenic
1151289727 17:73141007-73141029 GGGGCAGTGCCAGCTTCTGAGGG + Intergenic
1152063837 17:78098855-78098877 AGCGCTGTGCAGGCCTCTGATGG - Intronic
1152332487 17:79681165-79681187 AGGGGTGCACCAGCCTCTGGGGG + Intergenic
1153337088 18:3936034-3936056 AGGGGCATTCCAGCCTCTGCTGG + Intronic
1155527175 18:26729231-26729253 AGCACTGTACCAGCCTCTGGAGG - Intergenic
1155670043 18:28358961-28358983 ATGGCTGCTCCAGCCTCTGCTGG + Intergenic
1157569842 18:48705029-48705051 GAGCCTTTTCCAGCCTCTGAAGG + Intronic
1161361092 19:3850197-3850219 GGGGCTTTTCCAGCCTCTGGGGG - Intronic
1162498631 19:11038189-11038211 TTGGCTTTTCCAGCTTCTGATGG + Intronic
1163447917 19:17358376-17358398 GGGTCTGTTGCAGCCTCAGAGGG - Intronic
1164442611 19:28291062-28291084 GGGGCTGTTCCAGGCTCACAGGG - Intergenic
1165699925 19:37929692-37929714 AAGGCTGTTTCCCCCTCTGAGGG + Intronic
1165938066 19:39401538-39401560 AGGGCTGAGTCAGCCTGTGATGG - Intergenic
1166256217 19:41606667-41606689 AGGCCTGTACCAGCCCCTGCAGG + Intronic
1166794316 19:45417231-45417253 AGGGCTGTCTCAGCCACTGCTGG - Intronic
1167461195 19:49625529-49625551 AGAGCTGTTCCAGCCACGGCTGG - Exonic
925026415 2:610638-610660 GGGCCTATTCCTGCCTCTGAGGG - Intergenic
926711997 2:15889305-15889327 AGGGCTGTACCTGCCTCTCCAGG + Intergenic
927473447 2:23394093-23394115 AGGGATGTTCCGGCCGCTGTTGG - Intronic
933709430 2:85314796-85314818 TGGGCTTTACCTGCCTCTGAAGG + Intergenic
934793873 2:97084508-97084530 GAGGATGTTCCAGACTCTGAAGG + Intronic
935693893 2:105754029-105754051 AGGGCTGCTCAACACTCTGATGG - Intronic
937356889 2:121203292-121203314 AGGGCAGGTCCTTCCTCTGAAGG + Intergenic
938146892 2:128841977-128841999 GAGGCTGTTCCAGCGTCTGCAGG - Intergenic
941160081 2:162025908-162025930 GGGGCAGGTCCAGCCTGTGAAGG - Intronic
941366442 2:164617224-164617246 AGGGCTGTCCCTACCTTTGAAGG - Intronic
941957201 2:171216867-171216889 TTGGCTCTTCCAGCTTCTGATGG - Intronic
942686261 2:178535465-178535487 TGGACTGAGCCAGCCTCTGATGG - Exonic
943427789 2:187758618-187758640 AGTGCTGTTCTAGCTTCTGGTGG - Intergenic
943789402 2:191915515-191915537 AGGGCTTTTCCATCCTCTCCAGG + Intergenic
943794138 2:191970526-191970548 TGGGCTGTTCCAGCTTTTGGTGG - Intronic
945292013 2:208135950-208135972 AGGGTGATGCCAGCCTCTGAGGG - Intergenic
947054736 2:226087494-226087516 AGGGCTGTGCCACCCTCTTTTGG - Intergenic
947495472 2:230632729-230632751 AGGGCCTATCCCGCCTCTGATGG + Intergenic
947763942 2:232623992-232624014 AGGGCGGTGCCAGCCCCTGAAGG + Intronic
948692673 2:239716628-239716650 AAGGAGGTTCCAGCCTCTCAAGG + Intergenic
948708940 2:239813387-239813409 AGGGCTCCTCCAGCAGCTGAAGG - Intergenic
948918874 2:241052234-241052256 AGGGCTGGTCCAGGCCCTGGAGG + Intronic
948928394 2:241115132-241115154 AGGGTTCTTCCAGCTTGTGATGG - Exonic
1168815947 20:737118-737140 AGGGCTGGCCCAGCTCCTGATGG - Intergenic
1169756760 20:9051198-9051220 AGGGCTGTTCCAGCCTCTAGAGG - Intergenic
1171238684 20:23548003-23548025 TGGGCTGTTCCAGACTTTCAGGG + Intergenic
1171347805 20:24479202-24479224 AGGGCTGGGCCAGGCTCTGGTGG - Intronic
1173586476 20:44186846-44186868 GGGGCTCTTTCAGCCTCTGCTGG - Exonic
1174456431 20:50652004-50652026 AGGCCTGTGCCAGACTCCGAGGG - Intronic
1175542070 20:59754259-59754281 TCGGCTGCTGCAGCCTCTGAGGG - Intronic
1175662160 20:60823040-60823062 AGGGCTGAGACAGTCTCTGAAGG - Intergenic
1175856935 20:62126170-62126192 AGGGCTCCTCCAGCATCTCAAGG + Intronic
1175917516 20:62433534-62433556 AGGGCTGTGCCACTCACTGAGGG + Intergenic
1177783499 21:25644403-25644425 ATGGCTTTTCCAGCTTCTGGAGG + Intronic
1179484230 21:41699509-41699531 ATTCCTTTTCCAGCCTCTGATGG + Intergenic
1180943372 22:19675076-19675098 AGGACTGTCCCAGGCTCTGGTGG - Intergenic
1182675226 22:32034042-32034064 AGGGTGGTACCAGCCTCTGTAGG - Intergenic
1184178172 22:42801630-42801652 AGGCGTGTTCCAGCCTATGTTGG + Intronic
950364285 3:12472015-12472037 AGGGCTGTTCCTGGCTCGGGGGG + Intergenic
950431425 3:12953255-12953277 CCGGCAGTTCCAGGCTCTGATGG - Intronic
952047542 3:29341615-29341637 TGCAATGTTCCAGCCTCTGATGG - Intronic
954304335 3:49717530-49717552 AGAGCTGTCTCAGCCCCTGAGGG + Exonic
954325174 3:49859529-49859551 AGCGCTACTCCAGCCACTGATGG - Exonic
954693011 3:52405776-52405798 AGGGCCCCTGCAGCCTCTGAGGG - Exonic
954866234 3:53732302-53732324 AGGGCAGTCCCAGCTTCTGCTGG + Intronic
957636427 3:82791256-82791278 AGGGCTGTTGCACCCTCTTTGGG + Intergenic
960205127 3:114887609-114887631 CTGGCTCTTCCAGCTTCTGATGG - Intronic
961116759 3:124336382-124336404 AGTGAGGTACCAGCCTCTGAAGG + Intronic
961663544 3:128482925-128482947 GGGGCTGTTCCAGGCTCTGCAGG - Intronic
962665728 3:137651824-137651846 GGAGCTGATCCATCCTCTGAGGG - Intergenic
962853800 3:139326989-139327011 AGGGCTTTCCCTCCCTCTGATGG - Intronic
963043240 3:141084267-141084289 AGGGCTTGCTCAGCCTCTGAAGG + Intronic
964374160 3:156033254-156033276 AGGTCTGTTCCTGCTTGTGAAGG - Intergenic
965797710 3:172458461-172458483 ACAGCTCTTCCAGCTTCTGATGG + Intergenic
967080091 3:186042011-186042033 AGGCCTTTTTCAGCCTTTGAAGG + Intergenic
967421030 3:189272998-189273020 AGTGGTTATCCAGCCTCTGAAGG + Intronic
968613953 4:1569044-1569066 ACGGCTCTCCCAGCCTCTGGAGG - Intergenic
969420949 4:7095570-7095592 AGGAGTTTTCTAGCCTCTGACGG + Intergenic
969459743 4:7322616-7322638 TGGGCTGTCCCGGCCTCTCAGGG - Intronic
969502661 4:7562748-7562770 TTGCCTCTTCCAGCCTCTGATGG + Intronic
972213377 4:36865866-36865888 CGGGCTCTTCCTGCCTCTTATGG - Intergenic
975071043 4:70138774-70138796 AGAGATGTTTCTGCCTCTGAAGG + Intronic
976383000 4:84421519-84421541 ATGGCTGTTCCCGCTTGTGAAGG - Intergenic
977635495 4:99293478-99293500 ACTGCTGCTCCAGCCTCTGTGGG + Intergenic
978183907 4:105835558-105835580 AGGGCTGTGATACCCTCTGAGGG - Intronic
978663342 4:111154044-111154066 AGGGCTGTAACAGCCTCTTTGGG - Intergenic
979345327 4:119580043-119580065 AGGGCAAATCCAGCCTCTGGGGG + Intronic
981849792 4:149216808-149216830 AGTGCCCTTCCAGCTTCTGATGG - Intergenic
983897671 4:173099229-173099251 AGGGATGTTCCAGCCCCGCAGGG - Intergenic
985174499 4:187187140-187187162 AGGGCTCTTCCAGTCTCACATGG + Intergenic
985201772 4:187491387-187491409 AGAACTGTTCCAACCTCTGCTGG + Intergenic
985816198 5:2130085-2130107 TGGGCTGTCGCAGCCTCTGCAGG - Intergenic
985861091 5:2471298-2471320 AGGGGGGTGCCAGCCCCTGAGGG + Intergenic
985888308 5:2697157-2697179 AGGGCGGTTCCAGAGCCTGAGGG - Intergenic
987017683 5:13836970-13836992 AGGGCTGTTCCAGCCTCTGAAGG - Intronic
989217590 5:38921307-38921329 AGGATGATTCCAGCCTCTGAGGG - Intronic
989641863 5:43590520-43590542 AGGGCTGCCCCAGGCTCTGAGGG + Intergenic
990903169 5:60775159-60775181 AGAGCTGTTCCAAGCTCTTAAGG - Intronic
991970818 5:72140049-72140071 AGGACTGTTTGAGCCTCTGGAGG - Intronic
992084567 5:73266526-73266548 AGGACAGTTCCAGCCTCTTTCGG + Intergenic
992188024 5:74262752-74262774 AGGGCTTTTCTAACCTTTGATGG - Intergenic
993263028 5:85685114-85685136 AGGGCTATTCAAGCTTCTGCTGG + Intergenic
993407164 5:87526040-87526062 AGGGTTGTAGCAGTCTCTGATGG - Intergenic
996421278 5:123265659-123265681 AGGCCTCTTCCTACCTCTGAAGG + Intergenic
997443783 5:133926780-133926802 AGGACTTCTCTAGCCTCTGAGGG - Intergenic
997519612 5:134514410-134514432 AGGGCAGTTCCCTCCTCAGAAGG + Intergenic
998393503 5:141803225-141803247 AGGGCTGTCCCAGCCCTTCAGGG + Intergenic
998765719 5:145484946-145484968 GGGGCTCTTCTAGCTTCTGAGGG + Intronic
998945230 5:147331866-147331888 AGGCCTCTTCCAGCTTCTGTGGG - Intronic
1000954191 5:167522990-167523012 TGGCCTCTTCCAGCTTCTGAAGG + Intronic
1003216591 6:4118841-4118863 AGGGCTGTGCCAGCCTCCCTTGG - Intronic
1003260972 6:4515847-4515869 AGTGCTGTTCCAGGCACCGAGGG + Intergenic
1003399979 6:5783112-5783134 TGTGCTGTTCCAGCCTGGGACGG + Intergenic
1005421546 6:25656294-25656316 AGAGCTATTCATGCCTCTGAAGG - Intronic
1005871003 6:29974584-29974606 AGGGATGGTCCAGCACCTGAGGG + Intergenic
1006813393 6:36835375-36835397 AGAGCTCTTCCTTCCTCTGATGG - Intronic
1007433040 6:41787380-41787402 GGGGCTGTCCCAGCCTGTGGAGG - Intronic
1007658296 6:43466277-43466299 TGGGCTGCTCCAGCCCCTGCTGG + Intergenic
1008179816 6:48314599-48314621 AGGGGTGTTCCAGCTTTTGAGGG + Intergenic
1008376625 6:50798905-50798927 TTGTCTTTTCCAGCCTCTGATGG - Intergenic
1008610292 6:53179275-53179297 AGGACTTTGCCAGCCTCTGTGGG + Intergenic
1011473525 6:87731095-87731117 AGGACTTTTGCAGCTTCTGATGG - Intergenic
1013996683 6:116317027-116317049 AGGGCTCTTCCAGCCTCTCTGGG - Intronic
1014391786 6:120873169-120873191 AGGGCTGTGACACCCTCTGTGGG + Intergenic
1015244369 6:131061542-131061564 GTGGCTGTTGCAGCCACTGATGG - Intronic
1017406767 6:154127776-154127798 ATGCCTGTTCCTGCCTCTGCAGG + Intronic
1018615902 6:165686704-165686726 ATGGCTGTTGCACTCTCTGAGGG - Intronic
1020127850 7:5542899-5542921 AGGGCTGGTCCAGGCTCAGGTGG + Intronic
1020227327 7:6290543-6290565 GGAGCTGTCCCAGCCTCTGTGGG - Intergenic
1024598187 7:50957456-50957478 GGGCCTCTTCCAGCTTCTGATGG - Intergenic
1026604623 7:71805211-71805233 TGGGCTCTTCCACCTTCTGATGG + Intronic
1026833615 7:73624174-73624196 AGGGCGGTTCCGGGCCCTGACGG - Intronic
1030337965 7:108345961-108345983 TGGGCTGTAGGAGCCTCTGATGG + Intronic
1031923065 7:127615303-127615325 GGGGCTGTTGCAGGCTCTGAGGG - Intronic
1033231474 7:139601478-139601500 AGCATTGTTCCAGCCACTGAGGG - Intronic
1034254991 7:149720046-149720068 ACAGCTCTTCCAGGCTCTGAGGG - Exonic
1034420429 7:150987648-150987670 AGGGGTCTGCCAGCCTCTGGGGG + Intergenic
1034479375 7:151307921-151307943 AGCACTGTGCCAGCCTCTGAGGG - Intergenic
1034979036 7:155464325-155464347 TGGGCTGTCCCAGCCACAGATGG - Exonic
1037528430 8:19750303-19750325 AGGTTTGTCCCAGCCTCTGGTGG + Intronic
1037784341 8:21893546-21893568 AGGGCACTTGCAGCCTCTGAGGG + Intergenic
1042662450 8:71169990-71170012 AGAGGTGGTCCAGTCTCTGAAGG - Intergenic
1043229494 8:77783873-77783895 ATGACTATTCCAGCCTCTGGTGG + Intergenic
1047536586 8:125725647-125725669 AGGGCAGTCCCTGGCTCTGAAGG - Intergenic
1047853951 8:128889697-128889719 AGTGCTGTGCCAACCTCTGGAGG - Intergenic
1048805443 8:138237042-138237064 AGGGCTGTTCCGTCATCCGACGG - Intronic
1049434389 8:142579723-142579745 CGGGCTGCACCTGCCTCTGAGGG + Intergenic
1049800818 8:144516751-144516773 AGGGCTGGTCCGGCCTGGGAGGG + Exonic
1053049489 9:34947651-34947673 AGGCCTGTTATTGCCTCTGAAGG + Intergenic
1056072809 9:83006624-83006646 ATAGCAGTTCCATCCTCTGAAGG - Intronic
1056254157 9:84781235-84781257 AGGGCAATTCCTGCCTCTGTAGG + Intronic
1057082299 9:92181884-92181906 TTGGCTGTTCCAGCTTCTGGCGG + Intergenic
1059638940 9:116197330-116197352 GGGGCTGGTCAATCCTCTGAAGG - Intronic
1060267764 9:122122175-122122197 TGGGCTGGCCCAGCTTCTGAGGG + Intergenic
1060729926 9:126030801-126030823 AGGGCTGGTGCAGCCTCTTTGGG + Intergenic
1060738363 9:126080909-126080931 AGGTTGGTGCCAGCCTCTGATGG + Intergenic
1060782306 9:126421880-126421902 GGTGCTGTTCCTGCCTCGGAAGG - Exonic
1187005600 X:15230102-15230124 ACAGCTATTTCAGCCTCTGAAGG + Intergenic
1188440774 X:30213957-30213979 AGGGCTGTTCTGGACTTTGAAGG - Intergenic
1189211943 X:39291077-39291099 AGAGCTGTTGTAGCCACTGAGGG - Intergenic
1189231500 X:39455664-39455686 TTGGCTGTTGCAGCCTCAGAGGG - Intergenic
1189746347 X:44172473-44172495 AGAGCTGCTCCTGCCTCTGCAGG - Intronic
1190711313 X:53072782-53072804 CGGGCTGTTCCACAGTCTGAGGG + Intronic
1192168648 X:68841240-68841262 AGGGCTGTTCACGCCCATGAGGG + Exonic
1192948327 X:75989358-75989380 ATGGCTGTCCCAGCCTCTGGAGG - Intergenic
1200075397 X:153548158-153548180 AGGGCTGCGCCAGGCCCTGATGG - Intronic