ID: 987017976

View in Genome Browser
Species Human (GRCh38)
Location 5:13839349-13839371
Sequence CTCCACTTACAGACAGGTGA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 149}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987017976_987017979 18 Left 987017976 5:13839349-13839371 CCATCACCTGTCTGTAAGTGGAG 0: 1
1: 0
2: 1
3: 11
4: 149
Right 987017979 5:13839390-13839412 TGCAGCCTAAAAATTCATTCTGG 0: 1
1: 0
2: 0
3: 9
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987017976 Original CRISPR CTCCACTTACAGACAGGTGA TGG (reversed) Exonic
900931571 1:5741304-5741326 CTCCACCTGGAGCCAGGTGAGGG + Intergenic
902086848 1:13869210-13869232 CTCCACTTACAGATAAGTGGTGG - Intergenic
902279249 1:15362401-15362423 ATCCACTTACAGACAGGGAAAGG - Intronic
904801670 1:33097454-33097476 CTCCCCTTCCAGATAGGTCAGGG + Intronic
906025265 1:42668136-42668158 CATCACTTCCAGCCAGGTGAGGG + Intronic
906291601 1:44623019-44623041 CTCCTCTTCCAGCCAGGAGAGGG + Intronic
906562576 1:46770010-46770032 CTCCTCTTATATGCAGGTGAAGG + Intronic
908854482 1:68409164-68409186 CTCCACATACAGACAGTGGTGGG - Intergenic
913971822 1:143422409-143422431 CTGCACTTCCAGGCAGGGGAAGG - Intergenic
914066201 1:144248022-144248044 CTGCACTTCCAGGCAGGGGAAGG - Intergenic
914112952 1:144718332-144718354 CTGCACTTCCAGGCAGGGGAAGG + Intergenic
918643641 1:186876083-186876105 CTCCACTAAAGGAGAGGTGAAGG - Intronic
919622499 1:199878541-199878563 CTCCAATTATAGACTGGTGTAGG - Intergenic
921512980 1:216054796-216054818 GTCCAATTACAGACAGGCCAAGG - Intronic
922388603 1:225114387-225114409 CTCCACTTCAGGACAGGAGAGGG - Intronic
922983248 1:229846700-229846722 CTCCACTTGAAGACAGAGGAAGG + Intergenic
1066208475 10:33213114-33213136 CTCAACATGCAGACAGGAGACGG - Intronic
1066694047 10:38062123-38062145 CTCCCCTTTCTGACATGTGAGGG + Intronic
1067385247 10:45812738-45812760 GTCCACTGTCAGACCGGTGATGG + Intergenic
1067449776 10:46375214-46375236 GTCCACTGTCAGACCGGTGATGG - Intergenic
1067587475 10:47484550-47484572 GTCCACTGTCAGACCGGTGATGG + Intergenic
1067634531 10:47992316-47992338 GTCCACTGTCAGACCGGTGATGG + Intergenic
1067634720 10:47993650-47993672 GTCCACTGTCAGACCGGTGATGG + Intergenic
1069911318 10:71761591-71761613 CTGCAGGTGCAGACAGGTGAGGG - Exonic
1070141343 10:73740630-73740652 GTCCACTGTCAGACCGGTGATGG + Intergenic
1071366279 10:84903667-84903689 CACCACTTGCAGAGAGTTGATGG - Intergenic
1071610515 10:87027365-87027387 GTCCACTGTCAGACCGGTGATGG - Intergenic
1074285269 10:112091853-112091875 CCCAGCTTACACACAGGTGAAGG + Intergenic
1076247841 10:128961507-128961529 CTCCACCTCCACACAGGTGCTGG - Intergenic
1077823243 11:5773513-5773535 CTGGGCTTACATACAGGTGATGG + Intronic
1083180669 11:60982739-60982761 CTCCTCTGACAAACAGGAGATGG - Intronic
1088743245 11:112784263-112784285 CTCCCCCTACACACAGGTAAGGG - Intergenic
1092272814 12:7037083-7037105 CTCCCCTTAGAGGCTGGTGAGGG + Intronic
1095878737 12:47109265-47109287 CTCCATTTACAGAGAGAGGAAGG - Intronic
1104423007 12:128652585-128652607 CTCCACTTATAGGCACGTGGAGG - Intronic
1104996238 12:132659236-132659258 CTCCCATCACGGACAGGTGAGGG - Intronic
1112611661 13:100961045-100961067 CTCCACATATGGAGAGGTGAGGG + Intergenic
1112940373 13:104854536-104854558 CTCCACTTGAGGAGAGGTGAGGG + Intergenic
1120229690 14:81829413-81829435 CTCCACCTGCAGCCAGGTGCAGG - Intergenic
1123114817 14:105889924-105889946 CACCACTTACACACAGGCCAGGG - Intergenic
1124472612 15:30001724-30001746 CTCCAGTTGCAGACAGGAGCAGG + Intergenic
1126856205 15:52841811-52841833 CTAGAGTGACAGACAGGTGAAGG + Intergenic
1129752428 15:78075747-78075769 ACCCACTTACAGACAGGACAGGG + Intronic
1129826300 15:78637258-78637280 CTTTACTCCCAGACAGGTGAGGG - Intronic
1132810542 16:1794682-1794704 CCCCACTGACAGCCAGGGGAGGG - Intronic
1132855625 16:2043394-2043416 CCCCACTCAGAGACAGGTGCTGG - Intronic
1133023001 16:2975048-2975070 CTCCATTTACAGCCAGATTAAGG - Intronic
1134614036 16:15635876-15635898 CTCCACTTCCAGTCATGTCATGG - Exonic
1136233563 16:28901851-28901873 CTCCTCCCTCAGACAGGTGATGG + Exonic
1139027429 16:62835388-62835410 CTTTACTTAAAGTCAGGTGATGG + Intergenic
1140092505 16:71849949-71849971 GTCCACTGTCAGACCGGTGATGG - Exonic
1142034740 16:87856014-87856036 TCCCACTTACAGACAGGCCAAGG - Intronic
1147395522 17:40139802-40139824 CTGCACTTTGGGACAGGTGATGG + Intergenic
1148935841 17:51164221-51164243 CTGCCTTTACAGACAGATGATGG + Intronic
1150936232 17:69638671-69638693 CTCCTCTTACAGTCAGGACATGG + Intergenic
1151178953 17:72311986-72312008 CTCTGCTAACAGACAGGGGAGGG + Intergenic
1153309162 18:3661289-3661311 CTCCTCCCACAGACAGGTGGAGG + Intronic
1153971300 18:10229539-10229561 CTGCATTTGCAGACAGGTGCTGG + Intergenic
1154359279 18:13645492-13645514 CCCCACATACAGCGAGGTGATGG + Exonic
1158409798 18:57195812-57195834 CTACACATTCAGGCAGGTGATGG + Intergenic
1160630112 18:80241129-80241151 CTCCAGATTCAGACAGCTGAGGG + Intronic
1162915244 19:13871195-13871217 CACCAGTCACAGACAGGAGATGG + Intronic
1166303079 19:41922968-41922990 TCCCACTGACAGCCAGGTGAAGG + Intronic
1167952226 19:53036988-53037010 CTCCATGTCCAGAAAGGTGAAGG - Intergenic
925911082 2:8574040-8574062 CTCACCCTACAGACACGTGAGGG + Intergenic
926205834 2:10833819-10833841 CTCCACTTCCAGACACTTGATGG - Intronic
926834208 2:16999434-16999456 TTCCACTTACAGAGAGGAGAGGG - Intergenic
927970967 2:27306322-27306344 ATCGACTTCCAGCCAGGTGAAGG + Exonic
928316132 2:30248088-30248110 CTACACTAACAGAGAGCTGATGG - Intronic
930981204 2:57528383-57528405 TTCCACTTGCAGAAAGGAGAAGG - Intergenic
934176512 2:89583341-89583363 CTGCACTTCCAGGCAGGGGAAGG - Intergenic
934286822 2:91657702-91657724 CTGCACTTCCAGGCAGGGGAAGG - Intergenic
935165184 2:100563494-100563516 CTCCACTGAGAGCCAGGTGAGGG + Intronic
938212268 2:129478565-129478587 CTCTCCTTACAGAGAGGTGAAGG + Intergenic
940899872 2:159116839-159116861 CCCCACTTACAGTGAGTTGATGG + Intronic
941754370 2:169168807-169168829 TTCAACTTTCAGACAGGTCAAGG - Intronic
942352255 2:175065168-175065190 CTCCACTTAAGGAGAGGAGAGGG + Intergenic
942528991 2:176888040-176888062 CTCCTCACACAGACAGCTGATGG - Intergenic
942608444 2:177716236-177716258 CTCCAGCTACAGAGAGGGGATGG + Intronic
944086518 2:195853336-195853358 ATCCACCTATAGACAGGTAAGGG - Exonic
944449469 2:199826239-199826261 CTCCAATTGCAGACAGCTGGGGG - Intronic
1169290765 20:4349622-4349644 TCCCACTTTCAGAAAGGTGAGGG - Intergenic
1169733799 20:8814881-8814903 GTCCACTTACAGGCAGGAGTAGG + Intronic
1170951910 20:20944536-20944558 TTCCACTTGGAGGCAGGTGAAGG - Intergenic
1172619092 20:36307647-36307669 TTCCACTTCCAGGCAGGTGGGGG - Intronic
1175539414 20:59738968-59738990 CTCCACCTACAGACACCAGATGG - Intronic
1176939993 21:14912245-14912267 CTCCACTTGAAGAGAGGAGAGGG - Intergenic
1177760772 21:25400051-25400073 TTCCACTTGCAGAAAGGAGAGGG + Intergenic
1178890427 21:36516231-36516253 CTCCACTTACATAAAGTTGCGGG + Intronic
1180171846 21:46063583-46063605 CTCAACTTACAGTAAGGTTATGG + Intergenic
1183309443 22:37101501-37101523 CTCCTCTTCCAGACAGGGCAGGG + Intronic
1183584674 22:38746034-38746056 TGCCACTTACAGAAAGATGAAGG - Intronic
950602696 3:14048788-14048810 CGCTACTAACAGACAAGTGATGG + Intronic
952811834 3:37411256-37411278 CTCTACTTGTAGAAAGGTGAGGG - Exonic
952902567 3:38119878-38119900 CCCCACCTCCAGACATGTGAAGG + Intronic
953311436 3:41883942-41883964 CTCCATTTACAGACGGGCCAAGG - Exonic
957664146 3:83202075-83202097 CTCCCCTCAAGGACAGGTGAGGG - Intergenic
959610205 3:108285379-108285401 CTCCACTGACACTCTGGTGAGGG - Intergenic
962362036 3:134750612-134750634 CTCCCCTTGGAGACAGGTGGGGG + Intronic
963337535 3:143993764-143993786 CTCCATTTACAGATAGGTGTAGG - Intronic
964982433 3:162702868-162702890 CTCCACCTGCGGACAGGTGCGGG - Intergenic
968954819 4:3712867-3712889 CTCCACTGAGAAACAGCTGATGG - Intergenic
968958219 4:3729951-3729973 TTCAACTTTCAAACAGGTGATGG - Intergenic
970300121 4:14672368-14672390 CTCCACATAGAGCCAGGAGAGGG + Intergenic
970667523 4:18354465-18354487 CTCCACTTAAGGAGAGGAGAGGG - Intergenic
974290284 4:59921009-59921031 CTCCACTTGAGGACAGGAGAGGG + Intergenic
976777261 4:88720279-88720301 CTCCACTTACAGACTTCTGTTGG + Intergenic
979453514 4:120900557-120900579 CTTCACTTACACACTGGTGATGG - Intronic
982073652 4:151717707-151717729 TTCCACTTAGAAGCAGGTGAGGG - Intronic
985015156 4:185626156-185626178 CTACACTTGCAGAGAGGAGACGG + Intronic
985818008 5:2140866-2140888 CTCATCTGTCAGACAGGTGATGG - Intergenic
987017976 5:13839349-13839371 CTCCACTTACAGACAGGTGATGG - Exonic
994175283 5:96703584-96703606 CTCCACTTACACACAGGCAGGGG + Intronic
997375576 5:133394763-133394785 CTCCACCTGCAGCCCGGTGAGGG + Intronic
998349431 5:141491363-141491385 CTTCGCTGACAGAAAGGTGAAGG - Exonic
1000095954 5:157971014-157971036 CTCCACTTACAGATGGGTGCTGG + Intergenic
1000956245 5:167547059-167547081 TTCCACTTCCAGACAGATGCTGG - Intronic
1002708879 5:181182096-181182118 CTCCGCCTACAGGCAGGAGATGG + Intergenic
1002841598 6:911475-911497 GGCCATCTACAGACAGGTGAGGG + Intergenic
1002841603 6:911497-911519 GGCCCCCTACAGACAGGTGAGGG + Intergenic
1003089311 6:3088327-3088349 CCCCACTGACACAGAGGTGAAGG + Intronic
1004587068 6:17012965-17012987 CTCCACTTACACGCAGGGTAGGG - Intergenic
1006884752 6:37371857-37371879 CTCCACTTCTAGAAAGGTGAGGG + Intronic
1011219428 6:85038179-85038201 CTCCAGTTCCAGAAAGCTGAGGG - Intergenic
1016474479 6:144411441-144411463 CTCCACGGACAATCAGGTGAGGG - Intronic
1019275101 7:172108-172130 CTGCACGTGCAGACAGGGGAGGG + Intergenic
1020264823 7:6553377-6553399 CTGCACTTTGAGACAGGAGAGGG + Intergenic
1022172693 7:27844914-27844936 CTCTACTTAATGACAGGTGTTGG - Intronic
1022443859 7:30454253-30454275 CTCCACTTTGAGACAGCTGTTGG - Intronic
1023252137 7:38276063-38276085 ATCCGCTTACAGACAGGGAAGGG + Intergenic
1029541477 7:101185197-101185219 CTCCTCTTGCAGACAGAGGAAGG + Intergenic
1031129900 7:117820279-117820301 CTCCAGTTATTGACAGGTGGTGG - Intronic
1033542033 7:142366045-142366067 CTCCACTTAAAGACAGGAGAGGG - Intergenic
1034088194 7:148339445-148339467 CACCACTGAAAGGCAGGTGAGGG - Intronic
1034919586 7:155069112-155069134 CACCACTTAAAAACAGCTGATGG - Exonic
1039496613 8:37985475-37985497 CTCCACTAACCCAAAGGTGAAGG + Intergenic
1040483553 8:47849372-47849394 CTCCTCTTGCAGACAGGTATGGG - Exonic
1040730582 8:50442347-50442369 CTTCACTTAAAGACAGTGGAGGG - Intronic
1042732582 8:71953887-71953909 CTCCTCTAGCAGACATGTGAGGG - Intronic
1043935124 8:86133730-86133752 CCCCACTTACAGCCGGGTAAGGG - Intronic
1046057287 8:109093898-109093920 CCCAAGTTCCAGACAGGTGAAGG - Intronic
1048361757 8:133703449-133703471 CTCCATTTTCAGAGAGATGAAGG - Intergenic
1048574553 8:135680464-135680486 CTCCACTTCCAGACAACTCAAGG + Intergenic
1048875116 8:138830940-138830962 CTCCACACACAGCCAGGTGCTGG - Intronic
1049706741 8:144046563-144046585 CTCCACACACAGGCAGGTAAGGG - Intronic
1050078187 9:1887289-1887311 CTTCACTTAGAAAAAGGTGAAGG - Intergenic
1051175102 9:14352727-14352749 CTCCAATAACAGACAGGGAAAGG + Intronic
1053023926 9:34715222-34715244 GTCCACTCACAGACTGGAGACGG - Intergenic
1054753581 9:68933792-68933814 CTCCACTTAAAGAGAAGGGAAGG - Intronic
1055100355 9:72457895-72457917 CTGCACTTGAAAACAGGTGAGGG + Intergenic
1055139199 9:72856276-72856298 CTCCCCAAACAGACAGCTGATGG - Intergenic
1056567694 9:87789380-87789402 CTCCACTTTCACAAAGATGATGG + Intergenic
1056684896 9:88751575-88751597 CTGAACTTTCAGACAGCTGAAGG + Intergenic
1188653877 X:32666361-32666383 CTCCACTCCCAGACAGGCGATGG + Intronic
1190873471 X:54444035-54444057 CACCACTTCCAGAGGGGTGATGG + Exonic
1191587562 X:62845446-62845468 CTCCTCTTTCAGAGAGGTCATGG + Intergenic
1192554961 X:72082028-72082050 CTTCACCTAGAGACAGGGGAAGG - Intergenic
1192804105 X:74494883-74494905 CTCTACCTCCAGAAAGGTGAGGG + Intronic
1194985590 X:100486250-100486272 CTCCACTGTCAGACAAGTGGTGG - Intergenic
1199988168 X:152967347-152967369 ATCCATTTGCAGAAAGGTGAAGG + Intronic
1200015866 X:153163434-153163456 CTCAACTTGCAGACAGCTTATGG - Intergenic
1202023296 Y:20491422-20491444 CTCCACTTATGGAGAGGCGAGGG + Intergenic