ID: 987024186

View in Genome Browser
Species Human (GRCh38)
Location 5:13907436-13907458
Sequence CCCCCCAAAAAAAGAACCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 312
Summary {0: 1, 1: 1, 2: 2, 3: 37, 4: 271}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987024176_987024186 10 Left 987024176 5:13907403-13907425 CCTGGGCAAGAGTGAAACTCTGT 0: 13
1: 158
2: 526
3: 1540
4: 3408
Right 987024186 5:13907436-13907458 CCCCCCAAAAAAAGAACCTGGGG 0: 1
1: 1
2: 2
3: 37
4: 271
987024175_987024186 14 Left 987024175 5:13907399-13907421 CCAGCCTGGGCAAGAGTGAAACT 0: 39
1: 338
2: 1044
3: 2590
4: 8323
Right 987024186 5:13907436-13907458 CCCCCCAAAAAAAGAACCTGGGG 0: 1
1: 1
2: 2
3: 37
4: 271
987024174_987024186 24 Left 987024174 5:13907389-13907411 CCACTGCACTCCAGCCTGGGCAA 0: 66497
1: 175004
2: 225621
3: 191618
4: 110379
Right 987024186 5:13907436-13907458 CCCCCCAAAAAAAGAACCTGGGG 0: 1
1: 1
2: 2
3: 37
4: 271

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987024186 Original CRISPR CCCCCCAAAAAAAGAACCTG GGG Intronic
900832324 1:4973972-4973994 CCCCCCAAAGCAAGAAGCTCAGG + Intergenic
902254994 1:15182760-15182782 CCCCCCAAAAGAAGAAACAGTGG - Intronic
903578969 1:24357052-24357074 CCCCCCAAAAAAAAAATCCATGG + Exonic
904555652 1:31361755-31361777 CTCCCCAAAAAAAACACCTATGG - Intronic
906079778 1:43077650-43077672 CCCTTAAAAAAGAGAACCTGAGG - Intergenic
907197137 1:52696173-52696195 GTCTCAAAAAAAAGAACCTGGGG - Intronic
907268281 1:53275843-53275865 CCCAGCAAAAACAGAACCAGTGG + Intronic
908087410 1:60650965-60650987 CCCCTAAATAAAGGAACCTGGGG - Intergenic
910776983 1:90886641-90886663 TCCCCCAAAAAAAAAATCTACGG + Intergenic
910878328 1:91899152-91899174 ACCCCCAAAATAAGAATGTGAGG + Intronic
911157182 1:94648143-94648165 CCCTCCAAAAAACCAATCTGTGG - Intergenic
911317109 1:96369131-96369153 TCCCCCAATAGAAAAACCTGAGG + Intergenic
913650297 1:120907114-120907136 CCCTCAAAAACAAGCACCTGGGG + Intergenic
914170821 1:145221961-145221983 CCCTCAAAAACAAGCACCTGGGG - Intergenic
914525936 1:148465929-148465951 CCCTCAAAAACAAGCACCTGGGG - Intergenic
914640466 1:149601194-149601216 CCCTCAAAAACAAGCACCTGGGG + Intergenic
917104775 1:171481320-171481342 CCCCGCAAAAAAAAAACCTTTGG - Intergenic
917214515 1:172664349-172664371 CCCCTGAAAAAAAGGAGCTGAGG + Exonic
917332642 1:173898096-173898118 CCCCAAAAAAAAAGAAGTTGGGG - Exonic
917504020 1:175612125-175612147 TCCCCCAAAAACCCAACCTGTGG - Intronic
918535381 1:185568362-185568384 ACCTACAAAAAAAGAACATGTGG + Intergenic
920792635 1:209107330-209107352 CCACCCAGGAACAGAACCTGGGG + Intergenic
921592063 1:217015689-217015711 CCCCACACAAACAAAACCTGAGG - Intronic
923097620 1:230788151-230788173 CCTCCCAAAGAAAGCACCTGGGG - Intronic
923230359 1:231980803-231980825 CCCCTCAAAAAAAGGACCCCAGG - Intronic
923400640 1:233613397-233613419 CCCCTCACAAAAAGGACTTGAGG - Intergenic
923421283 1:233817806-233817828 GCCCCCAAACAAAGAGGCTGAGG + Intergenic
924649493 1:245912267-245912289 CCCCCCAAAAAAAGACACCTAGG + Intronic
1063303598 10:4876253-4876275 CTCCCCAATAAAAGTATCTGAGG - Intergenic
1063774391 10:9244597-9244619 CCCTCCAAGAAAAGAGACTGGGG - Intergenic
1064233296 10:13549003-13549025 CCCCCCTAAAAAAAAACCTAAGG - Intergenic
1064477957 10:15711768-15711790 CCCCCCAAAAAAAGAAAGAAAGG + Intronic
1065555475 10:26911299-26911321 CCCCCCAAAAAAACTACCTGAGG + Intergenic
1066319672 10:34289175-34289197 CCCCTCAAAAAAAGACCCGCAGG - Intronic
1068638453 10:59374420-59374442 CCTCCCATAAAAATAACTTGTGG - Intergenic
1068934542 10:62622846-62622868 CCCCCCAAAAAAAGGATTTGAGG - Intronic
1069058049 10:63865283-63865305 TCCCCCAAAAGCAGAGCCTGGGG - Intergenic
1069532738 10:69231002-69231024 CCCCAGAAAAAAGGAACCAGTGG - Intronic
1070027866 10:72649446-72649468 CCCGCCAAAAAAAAAAGTTGTGG - Intergenic
1070353821 10:75619536-75619558 CAGCCCAAAAATAGAACCTTTGG - Intronic
1070935551 10:80291982-80292004 CCCCCCAATAAAAAAACATAAGG - Intergenic
1071424523 10:85535382-85535404 CTCCCCAAAAGAGGAGCCTGTGG + Intergenic
1071730585 10:88244376-88244398 CCCCCCATAATATGAACCTCTGG + Intergenic
1072206478 10:93209738-93209760 CCCCCCAAAAAAAAAACCTGGGG + Intergenic
1072955575 10:99885214-99885236 CCCCCCACAAAAAAAGCCTGGGG + Intronic
1073031976 10:100533829-100533851 CCCCCCAAAAAAAGCATATAAGG - Intronic
1074792576 10:116905391-116905413 CCCCCCAAAACAACTACCTCAGG - Intronic
1076018901 10:127053870-127053892 TCCCCCAAAAAAACAAGCAGAGG - Intronic
1077068675 11:657152-657174 CTTCCCAATAAAAGGACCTGGGG + Intronic
1077532263 11:3102952-3102974 CCCCCCAAGAAAACAGCCTCAGG - Intronic
1079087263 11:17455471-17455493 GCCCCCAACAAAATAACCTAGGG + Intronic
1080057764 11:27925090-27925112 CCATCCAAAAAAAAAAACTGAGG + Intergenic
1080065704 11:28010397-28010419 CTCCCAAAAAAAAGAAATTGTGG - Intergenic
1081853879 11:46291861-46291883 CCTTCCAAAAATAAAACCTGAGG + Intronic
1083956707 11:65987821-65987843 CCCCCCAAAAAAGGAATGTGTGG + Intergenic
1084871999 11:72104784-72104806 CCCCTCAAATCAAGACCCTGAGG + Intronic
1084913667 11:72411612-72411634 CCTCCCACAAACAGAGCCTGGGG - Intronic
1085188172 11:74593739-74593761 CCCCCAAAAAAAACATCATGAGG + Intronic
1086251914 11:84825986-84826008 CCCCCCAAAAATAAACACTGAGG - Intronic
1087006226 11:93474804-93474826 ACTTCCAAAAAAAAAACCTGAGG + Intergenic
1088209557 11:107439613-107439635 CCCTACAAAAAAAGAAAATGCGG - Intronic
1088746432 11:112808395-112808417 ACCCCCAGAGACAGAACCTGGGG - Intergenic
1089562779 11:119353358-119353380 CCCCTCAAAATAAAAACATGAGG - Intergenic
1091075875 11:132616052-132616074 CCCCAGAAAAAAATATCCTGAGG - Intronic
1093171813 12:15869671-15869693 CTCCTCAACAAATGAACCTGGGG - Intronic
1093403159 12:18771944-18771966 CCCCCCAAAAAAAAAGCTAGAGG - Intergenic
1094478887 12:30864251-30864273 CTTCCCAGAAAAAGAAGCTGAGG - Intergenic
1096096084 12:48936645-48936667 GCCCCCAAAAAAACAAGGTGAGG + Exonic
1096897997 12:54844239-54844261 CCCCCAATAAAAAAAATCTGGGG - Intronic
1097815759 12:64071874-64071896 CCCCCCAAAAAAAAAAGTCGTGG + Intronic
1098481469 12:70966885-70966907 CACCCTCAAAAAAGAAACTGAGG + Intergenic
1099170004 12:79352190-79352212 CCCCCCCAAAAAAAAAACGGGGG + Intronic
1099170006 12:79352191-79352213 CCCCCCAAAAAAAAAACGGGGGG + Intronic
1099832323 12:87859618-87859640 ACCCCCAAAAAAAGACTTTGAGG + Intergenic
1102042181 12:109808196-109808218 CGACCCAAAGAAAGAAGCTGAGG + Intronic
1102461153 12:113100293-113100315 ACCCCCAAAAAAAGAAGCTAAGG - Intronic
1102880593 12:116481918-116481940 CCCACCAAAAAAACAATGTGGGG + Intergenic
1103832095 12:123788120-123788142 CCCTTCAAAGAAAGAACCTACGG + Intronic
1104583827 12:130031040-130031062 TCCCCAGAAAAAAGAATCTGAGG - Intergenic
1107730540 13:43344073-43344095 CCCCCAGATAAAAGATCCTGAGG + Intronic
1108349093 13:49574108-49574130 ACCCCCAAAAAAAGAAATTTGGG - Intronic
1108512309 13:51167482-51167504 CCTCCCAAAAACAGAGCCTAAGG + Intergenic
1109830505 13:67781025-67781047 CTCCCCAAAAGAAAAACCTGAGG - Intergenic
1109879010 13:68446613-68446635 CCCCCAAAAAAAAACAACTGGGG + Intergenic
1110438724 13:75504225-75504247 CACCCCAGAAAAGCAACCTGAGG + Intergenic
1111763610 13:92498251-92498273 CACCCCAAGAAAAGAATCAGGGG - Intronic
1113070252 13:106413488-106413510 TCCCCCAAAAAATCAGCCTGAGG + Intergenic
1113228556 13:108186195-108186217 CCCTCCAAAGAAGGAAACTGAGG - Intergenic
1115422322 14:33210429-33210451 GCCCCCAAAAATAGAAGTTGAGG + Intronic
1116248391 14:42449746-42449768 CCCCACATAAAAAGAACTTTAGG + Intergenic
1117813075 14:59568998-59569020 CCCCCAAAAAGCAGAGCCTGAGG - Intronic
1119804989 14:77476700-77476722 TCCCTCAAAACAAAAACCTGAGG + Intronic
1120208630 14:81612636-81612658 CACCCCAAAAGAAGAATCAGGGG + Intergenic
1120789872 14:88569948-88569970 CCCCCCACAAAAAAAGACTGTGG + Intronic
1121466072 14:94116272-94116294 CTCCCCAAACAAAGACCCCGAGG + Intronic
1122475893 14:102008783-102008805 TCCCCCAAAAAAAGAAACCCAGG + Intronic
1127455308 15:59151445-59151467 CCCCCCAAAAAAACCAACTAAGG + Intronic
1127712546 15:61614159-61614181 ACCCCCAACAAAAGATCCAGAGG + Intergenic
1128277534 15:66366148-66366170 CCTCCCAAAAAAAAAAACTGGGG + Intronic
1130394840 15:83492918-83492940 TCCCCCAGAAACAGACCCTGGGG - Intronic
1133344590 16:5061507-5061529 CCCCCAAAAAAAAAAACAAGTGG + Intronic
1133914715 16:10098935-10098957 CCCCCCCCAAAAAAAACCTATGG + Intronic
1134786723 16:16951496-16951518 CCCCTCTAGAAAAGAACCAGAGG + Intergenic
1134814015 16:17191142-17191164 CCAACCAAGAAAAGAAACTGAGG + Intronic
1134837289 16:17371937-17371959 CCCCCCAAAAAAAGTTGCTATGG + Intronic
1135529034 16:23236769-23236791 CCCCCCAAAAGAACTACTTGAGG - Intergenic
1135885338 16:26300947-26300969 CCCAGGAAAAAAAGAACCTGAGG + Intergenic
1136419928 16:30125429-30125451 CCCCCCAAAAAAAGGGACAGAGG + Intergenic
1136518399 16:30781640-30781662 TCCCCCAAAAAAATTACATGGGG - Exonic
1137466294 16:48712852-48712874 CCCCCCACAAAAAAAAACTTAGG - Intergenic
1139649212 16:68353813-68353835 CCCCACTAGAAAAGAAGCTGTGG - Intronic
1140459767 16:75130353-75130375 CACCTCAAAAAAAGAATCAGGGG - Intergenic
1141944298 16:87298893-87298915 CACCCCAAAAGCAGAGCCTGAGG + Intronic
1143061954 17:4209292-4209314 CCCCCCAAAAAAGATAGCTGAGG - Intronic
1143721485 17:8814118-8814140 CCCCCCACAGAAAGAACCATGGG + Intronic
1143865839 17:9922810-9922832 CCACCACAAATAAGAACCTGTGG + Intronic
1143979036 17:10852113-10852135 CCCCCCAAAAAAACATGCAGTGG - Intergenic
1146652870 17:34617195-34617217 TCTCCCAAAGAAAGAAGCTGAGG + Intronic
1147136392 17:38436390-38436412 CCCCCCCAAAAAAAACGCTGAGG + Intronic
1147625538 17:41897487-41897509 ACCCCCATAAGAAGAACCAGGGG + Intronic
1150942603 17:69708847-69708869 TCCCTCTAAAAAAGAACCTGTGG - Intergenic
1152307078 17:79527403-79527425 CAACACTAAAAAAGAACCTGGGG + Intergenic
1152972453 18:176154-176176 CCCCCCAAAAAAAAAACATTTGG + Intronic
1153619351 18:6962408-6962430 CCCCCCAAAACAAGAAAGGGCGG + Intronic
1153969592 18:10213975-10213997 CCTTCCCAAAAAAGTACCTGTGG + Intergenic
1156141102 18:34112366-34112388 CCCCCCAAAAAAAAAAGATATGG + Intronic
1156561254 18:38128267-38128289 CTCCCCAAAAATAGAGCTTGGGG - Intergenic
1157683716 18:49626716-49626738 CCCCCCAAAAAAAAATCCTCTGG + Intergenic
1159056970 18:63475983-63476005 CCCGCCAAATGAAGAAGCTGTGG + Intergenic
1160167881 18:76529927-76529949 CCCCCCAAAAAAAGAAGTAGCGG - Intergenic
1160546793 18:79662856-79662878 CCTCTCAAAAAAACAACCTTGGG + Intergenic
1161557180 19:4950544-4950566 CCCCCCAAAAAAGGAAACACAGG - Intronic
1162354032 19:10169855-10169877 CCTTCCAAAGAAGGAACCTGGGG - Intronic
1163571048 19:18082501-18082523 CCCCCAAAAAAAAACACCAGAGG - Intronic
1163991321 19:21001694-21001716 CTTCCCATAAAAAGAACCTTTGG + Intergenic
1167374477 19:49103610-49103632 CCCCCCCAAATAACAACCAGAGG - Intronic
1168283192 19:55316952-55316974 CCTCCCAGGAAAAGAACCAGCGG - Exonic
1168423711 19:56222273-56222295 CCCCCCAAAAATAGCCTCTGTGG - Exonic
925678136 2:6387796-6387818 CACCCCAAAAAATGCATCTGTGG - Intergenic
926179207 2:10625720-10625742 CCCCACAAAAAAAAAGCCTGGGG + Intronic
927443016 2:23132902-23132924 CCCCACAAAAAATGGCCCTGGGG + Intergenic
928301358 2:30128036-30128058 GCCCCCAAAAACAGAATCAGAGG - Intergenic
929027662 2:37620198-37620220 ACCCCCCAAAATAGAACTTGTGG + Intergenic
930223939 2:48773234-48773256 CTCCCCAGAAAAAGAATCTCAGG - Intronic
932047673 2:68365779-68365801 CCTCCCAAAAAAAGAACTGAGGG - Intronic
933086764 2:78063010-78063032 TCCCAGAAAAAAAGAAGCTGAGG + Intergenic
933136570 2:78743002-78743024 CACCCCAAAAGAAGAATCAGGGG - Intergenic
933792683 2:85895670-85895692 ACCCCCAAAAAAAGAGCCCTAGG + Intergenic
933936402 2:87207350-87207372 CACCCCAAAGAAAGAATCAGGGG - Intergenic
935310294 2:101776582-101776604 CCCCCCAAAAAAAAACACTATGG + Intronic
935694742 2:105761306-105761328 CCTCCCAAAAAAAGATTCTCTGG - Intronic
936356747 2:111758479-111758501 CACCCCAAAGAAAGAATCAGGGG + Intergenic
936676814 2:114725220-114725242 CCACCTAAAGAAAGAAGCTGAGG - Intronic
938203872 2:129400715-129400737 CCCCCCAAAAAAAAAATCCCAGG + Intergenic
938677925 2:133657714-133657736 CCTCACAATAAAAGAATCTGAGG - Intergenic
939893317 2:147763073-147763095 CCCTCCAAAAAACGCACTTGTGG + Intergenic
940620117 2:156101912-156101934 TCCCCCAAAAAAACAGCATGAGG + Intergenic
941237407 2:162992446-162992468 CCCCCCAAAATTAGAGCCTAGGG + Intergenic
941256576 2:163239788-163239810 CCCGTCAAAAACAGAAACTGCGG - Intergenic
943571264 2:189578011-189578033 CCCCACACAAAACTAACCTGAGG + Intronic
945317784 2:208389788-208389810 CCCCGCAAAAAAAGAAAAAGCGG - Intronic
947680704 2:232029723-232029745 TCCCCCAAGAAAACAAACTGAGG - Intronic
948162739 2:235838191-235838213 CCCCCCAAAAAAAGAAAAGAGGG + Intronic
948465687 2:238150618-238150640 CCCACCAAAAGAAGAGTCTGAGG + Intronic
1169523738 20:6400813-6400835 CCTTCCAAAAGTAGAACCTGAGG - Intergenic
1169660700 20:7975458-7975480 CCCTCAAAAAAAAGAAAATGAGG + Intergenic
1169830916 20:9823800-9823822 CCCCCCAGAAACAGACCTTGAGG - Intronic
1171391587 20:24804853-24804875 CTCCACAAACAAAGAACGTGCGG - Intergenic
1173908219 20:46644177-46644199 CCCCCACAAAAAGGAAACTGAGG - Intronic
1178268766 21:31169746-31169768 CTCCCCAAAAAAGGTACTTGGGG + Intronic
1180746525 22:18092807-18092829 CCCCCCAAAAAAAAGAAATGGGG - Exonic
1180889748 22:19278303-19278325 AGCCCCAAAATAAGAACATGGGG + Intronic
1181433715 22:22898237-22898259 CCTCCCAAAACAAGAACCCAGGG + Intergenic
1182128648 22:27834813-27834835 TCCCCCAAAAGAAGACCCTCGGG + Intergenic
950194242 3:10998087-10998109 CCATCCAAAAGATGAACCTGAGG + Intronic
951104051 3:18722373-18722395 CCATACAAAAAAAGAAACTGGGG - Intergenic
953733458 3:45469823-45469845 CCCACCAAAAAAAGAAATTTTGG + Intronic
954422107 3:50424256-50424278 CTGCCCCAAAAAAGAACCTGTGG - Intronic
954501930 3:51025604-51025626 CACCCCATGAACAGAACCTGGGG - Intronic
954861106 3:53691146-53691168 CCCCCCAAAAAAAAAAAAAGAGG - Intronic
954989400 3:54827101-54827123 CACCCCAAAACAAGAGTCTGAGG + Intronic
955770211 3:62378044-62378066 CCCCCCAAAAAAAAAAAGTCAGG - Intergenic
955872434 3:63453292-63453314 CCCCCCAACAGAAGAGCCTGGGG + Intronic
958835855 3:99144023-99144045 CCCCACAGAGAAAGAAACTGAGG - Intergenic
959072015 3:101711233-101711255 CCTCACAAAAAAAGAAAGTGAGG - Intergenic
961002607 3:123384182-123384204 GGCCCCAAGAAAAGACCCTGAGG + Intronic
961516784 3:127442891-127442913 CCCCCCAACAATAGCACTTGGGG - Intergenic
962961222 3:140313159-140313181 CCCCCCAAAAAAACCATCAGTGG + Intronic
963790149 3:149575092-149575114 CCCCCCAAAAAAAAAAGATGGGG + Intronic
967137353 3:186523660-186523682 GACCCCAAAAAAAAAACCTCCGG + Intergenic
967490459 3:190085055-190085077 CTCCCCAAGCAAAGAACCTTAGG - Intronic
968285168 3:197504341-197504363 CCGCCCAAAAAAAGAAACTAAGG + Intergenic
968320622 3:197764844-197764866 CCCCCCAAAAAAAAAAAGTATGG - Intronic
968683560 4:1939423-1939445 CCCCCAAAAACATCAACCTGGGG - Intronic
969249586 4:5958199-5958221 CCCCCCAAAAAGAGAGTCTAGGG - Exonic
970035122 4:11724326-11724348 ACCACTACAAAAAGAACCTGAGG - Intergenic
972283675 4:37628015-37628037 CCCCCCAAAAAAAGTATGTTTGG - Intronic
972539604 4:40027969-40027991 CTCCCCAGAAAAAGTACTTGTGG + Intergenic
972585901 4:40436937-40436959 CCCCGCCAAAAAAAAAACTGTGG + Intronic
972598257 4:40549091-40549113 CCCCAAAAAAAAAGAAACTGAGG - Intronic
972955746 4:44388888-44388910 CCCACCAAAAAAAGATAATGTGG + Intronic
973265553 4:48206986-48207008 CCCCACAAATAAAGAACGAGGGG + Intronic
974051227 4:56944065-56944087 CCCCTCAAAAACAGAACTTTGGG + Intergenic
975629429 4:76385341-76385363 CCCAGAAAAAAAAGAACCAGAGG + Intronic
975812009 4:78179321-78179343 CTCCACAGAAAAAGCACCTGTGG + Intronic
978553027 4:109948479-109948501 CCCCCCAAAAAAAAATCCGAAGG - Intronic
978797547 4:112723347-112723369 CCCCACAAAAAAAAATCTTGAGG - Intergenic
982103771 4:151993805-151993827 CACCCCAAGAGAAGAACCAGAGG - Intergenic
983437924 4:167739641-167739663 CCCACCAAAAAAACAAGCTTTGG - Intergenic
987024186 5:13907436-13907458 CCCCCCAAAAAAAGAACCTGGGG + Intronic
988241505 5:28615032-28615054 CCCCCCAAAAAAGAAAGCAGTGG - Intergenic
988988455 5:36645227-36645249 ATCCCCAAAAACAGAACTTGAGG - Intronic
989981400 5:50649660-50649682 CCCTCAAAAACAAGCACCTGGGG + Intergenic
990958981 5:61373301-61373323 CCCTCCAAAAAAAGACCCAGTGG - Intronic
991447105 5:66711838-66711860 CCCCCCAAAAAAAGATGCTTTGG + Intronic
992359586 5:76023353-76023375 CCCCCCACAAAATGATCCTTTGG - Intergenic
993075849 5:83229521-83229543 CCCCCCAAAATAAGAACCACTGG - Intronic
993458188 5:88149318-88149340 CCCCCCAGAAAAACCATCTGAGG + Intergenic
994039385 5:95241030-95241052 CCCCCCAAAATTAGAATCTCTGG - Intronic
994944548 5:106369270-106369292 CCCTCAAAAAAAAAAAACTGGGG + Intergenic
995168909 5:109082966-109082988 CCCCCCAAAAAAAGAAAAAAAGG + Intronic
995231667 5:109771875-109771897 CCCCCCAAAAAAAGAACAAAGGG - Intronic
997105792 5:131018132-131018154 CCCCCCAAAACAAGAAACCAAGG - Intergenic
997352063 5:133238303-133238325 CCTCCCACAAAGAGAACCAGGGG - Intronic
998096713 5:139399937-139399959 ACTTCCCAAAAAAGAACCTGGGG - Intronic
998240056 5:140433057-140433079 CCCCCCCAAAAAAAAAACGGGGG + Intronic
1000125490 5:158239606-158239628 CCCCCCAAAAGAGGAACTTATGG - Intergenic
1001313475 5:170627218-170627240 CTCTCAAAAAATAGAACCTGGGG + Intronic
1001466286 5:171969275-171969297 CCCCCAAAAAAAAGAATGTATGG + Intronic
1003083451 6:3041287-3041309 CCCACCACAGAAAAAACCTGTGG - Intergenic
1003269230 6:4592576-4592598 CCCCACAAATGAAGAAACTGAGG - Intergenic
1003378803 6:5603829-5603851 CCTCCCAAAAAAAGATAATGTGG - Intronic
1004010589 6:11682276-11682298 CCCCTTAAAGAAGGAACCTGTGG - Intergenic
1004960173 6:20779486-20779508 CACCCCAAAATAAGAATTTGGGG - Intronic
1005749777 6:28871994-28872016 CCACCAGAAAAAAGAAACTGCGG - Intergenic
1006031768 6:31181233-31181255 CCCCCCAAAAAAATAATTTGGGG + Intergenic
1006206139 6:32344845-32344867 AGCCCCAAAAAAAAAACCTAAGG - Intronic
1007059498 6:38924506-38924528 CCCCCAAAAAAAAGAAACCCAGG + Intronic
1007080615 6:39100453-39100475 CTCCCCCAAAAAAGAAGGTGGGG - Intergenic
1008206277 6:48662288-48662310 CCTCCAACAAAAAGAACCAGGGG - Intergenic
1009451836 6:63810307-63810329 CCCCCCCCCAAAAAAACCTGCGG + Intronic
1009457055 6:63869912-63869934 CCCCCCATAAAAAAAATCTCAGG + Intronic
1013971951 6:116030602-116030624 CCTCCATAAAAAAGAACATGTGG + Intronic
1015824886 6:137301008-137301030 CACCCCAAGAAAAGAATCAGGGG - Intergenic
1017030653 6:150218480-150218502 CCCCCCAAAAAAAAATTCTGAGG + Intronic
1018644864 6:165938584-165938606 AACCCCAAAAAACGCACCTGGGG + Intronic
1019632559 7:2057524-2057546 CCCCCAAAAAGAAGAAGTTGGGG + Intronic
1020914523 7:14175801-14175823 CCCCCAAAAAAAAGACACTAAGG - Intronic
1021242774 7:18224886-18224908 CCCCCCAAAAAAAGCTGCAGAGG + Intronic
1021752385 7:23815816-23815838 GCCCCTAAAAAAAGTACTTGGGG + Intronic
1022060245 7:26786031-26786053 CACCCCAAGAACTGAACCTGTGG + Intronic
1023159348 7:37282616-37282638 CCCCCCAAAAAAAGAAACAGGGG + Intronic
1023472061 7:40534216-40534238 CACCACAAAAACAGAATCTGTGG - Intronic
1024622569 7:51174876-51174898 CGGCCTAAAAAAAGAAACTGAGG - Intronic
1025983591 7:66428396-66428418 CCCCACAAAAAAAGTAGTTGAGG - Intergenic
1026553498 7:71387312-71387334 CCCCCCAAAAAAAGAACACCAGG - Intronic
1027008119 7:74714800-74714822 CCCCCCCAAAAAAAAATGTGGGG - Intronic
1027035615 7:74922987-74923009 CCACCCTAAGAAAGAAACTGTGG - Intergenic
1027647466 7:80821410-80821432 CCCCCAAAAAAAAACAACTGTGG - Intronic
1027695886 7:81409913-81409935 CCCCCCAAAAAATGAAACAAAGG + Intergenic
1028233581 7:88333303-88333325 CCCCCAAGAAACAGATCCTGAGG - Intergenic
1028516002 7:91679011-91679033 CCCTGCAAAAAAAGGAGCTGGGG - Intergenic
1029394443 7:100298150-100298172 CCACCCTAAGAAAGAAACTGTGG + Intergenic
1029851833 7:103469616-103469638 TCCCCCAAAAAAAGAAAATGTGG - Intergenic
1029918017 7:104231739-104231761 ACCCCAAAATAAAGGACCTGGGG + Intergenic
1032392842 7:131567325-131567347 GCCCTCAAAGAAAGAACTTGAGG - Intergenic
1032637049 7:133720484-133720506 ACCCCCAAAATAAGATCCTATGG - Intronic
1032711916 7:134468240-134468262 CCCCCCAAAAAAAACACCCATGG + Intergenic
1034166197 7:149026995-149027017 CCCCCCAAAAACAGAATCACTGG + Intronic
1034186424 7:149181017-149181039 CACCCCAAGAAAAGAACATGTGG - Intronic
1035671753 8:1423361-1423383 CCTCCCAGAGACAGAACCTGGGG - Intergenic
1036806299 8:11836621-11836643 CCTCCTAAAAGCAGAACCTGAGG - Intronic
1038451889 8:27644929-27644951 CCCCCCCAAACAAGAACCCTTGG + Intronic
1038627249 8:29206120-29206142 CCCCACAAAAAAAGAGGCTGGGG + Intronic
1039375000 8:37024290-37024312 TCCCTCAAAAGCAGAACCTGAGG + Intergenic
1042237867 8:66632675-66632697 CCCCCCAAAAAAAGTTCCAGTGG + Exonic
1043737196 8:83763653-83763675 GCCTCCATAAAAAGAATCTGAGG + Intergenic
1044490696 8:92810848-92810870 CCCCCCAAAAAATCTACCTGGGG + Intergenic
1047677067 8:127213908-127213930 TCCCCTAAAATAAGAATCTGTGG - Intergenic
1048139476 8:131779261-131779283 CCCCCCAAAAAAAGAAAAAAAGG - Intergenic
1048294828 8:133206476-133206498 CCCCCCAAAAAAAGGAGTGGGGG - Intronic
1048348703 8:133598177-133598199 CCCCCCAAAAAAGGGATTTGGGG + Intergenic
1048847814 8:138616704-138616726 GCCCCCAGAAAAACCACCTGAGG + Intronic
1050815537 9:9806947-9806969 CACTCCAAAGGAAGAACCTGGGG + Intronic
1050928233 9:11293182-11293204 CCCACCAAAAAAGGAACTTGAGG - Intergenic
1051620214 9:19043168-19043190 TCCCCCCAAAAAAGAAAATGTGG + Intronic
1052848630 9:33361417-33361439 CCCCCAAAAATAAGAATGTGAGG - Intronic
1053241780 9:36501930-36501952 CCCCCCGCAAAAAAAACCTCTGG - Intergenic
1054727655 9:68668037-68668059 CCCTCAAAAAGAAGACCCTGAGG - Intergenic
1055094721 9:72400288-72400310 CCCCCCTATAAGAGAACATGCGG - Intergenic
1056471115 9:86905162-86905184 CCTCCCCAAAAAAGACCCTAAGG + Intergenic
1059714102 9:116897118-116897140 GCTCCCAAAAAAATAACCTCAGG + Intronic
1060689403 9:125643193-125643215 CCCCCCAAAAAAAAAACGCTGGG - Intronic
1061342665 9:129995669-129995691 CCCCCCAAATAAAGAATGAGAGG + Intronic
1186568920 X:10694101-10694123 TGCCCCAAAGAAAGAATCTGTGG - Intronic
1186970083 X:14832470-14832492 CCCCCCAAAAAGATATGCTGAGG - Intergenic
1187111460 X:16305250-16305272 CCCCCCAAAAAACCAATCTCTGG - Intergenic
1187275573 X:17814024-17814046 TCCCCCACAAACAGACCCTGAGG + Intronic
1187496277 X:19798599-19798621 CCTCCCAAAACAAGGTCCTGGGG - Intronic
1187797549 X:23020951-23020973 CCCCCCAGAAAAAAATCATGGGG - Intergenic
1189078671 X:37944899-37944921 TCCCCCAAAAGTAGACCCTGAGG - Intronic
1190287349 X:48970367-48970389 CCACCCAAACAAGGAAACTGGGG + Exonic
1190295722 X:49026234-49026256 CCCCCCCAAAAAAAAACCTCTGG + Intergenic
1190948779 X:55121930-55121952 CCCTCCAGACAAAGAACGTGAGG + Intronic
1192490075 X:71568884-71568906 AAAACCAAAAAAAGAACCTGAGG + Intronic
1194534931 X:95094648-95094670 CTGCCCAAAAAAAGACCCAGAGG + Intergenic
1195764682 X:108283572-108283594 CCCCCCAAAAAAAAAACTTAGGG - Intronic
1195764684 X:108283573-108283595 CCCCCCCAAAAAAAAAACTTAGG - Intronic
1197681034 X:129385463-129385485 CCCTCCAAAAAAAGTCCCAGTGG + Intergenic
1198714371 X:139540878-139540900 CCACCCAAACAAAGATCCTTAGG - Intronic
1199869354 X:151883547-151883569 ACACACAAAAACAGAACCTGAGG - Intergenic
1200437533 Y:3170381-3170403 CCCCCCAAAAAAAGAAAAAAAGG - Intergenic