ID: 987025910

View in Genome Browser
Species Human (GRCh38)
Location 5:13926188-13926210
Sequence AAGGAGCACCTGAGGGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987025899_987025910 23 Left 987025899 5:13926142-13926164 CCCTGCTGAAAAGAGCCAGACTG 0: 1
1: 0
2: 2
3: 23
4: 339
Right 987025910 5:13926188-13926210 AAGGAGCACCTGAGGGAGGATGG No data
987025905_987025910 -6 Left 987025905 5:13926171-13926193 CCTTAAATCCTACTCAAAAGGAG 0: 1
1: 0
2: 4
3: 15
4: 143
Right 987025910 5:13926188-13926210 AAGGAGCACCTGAGGGAGGATGG No data
987025898_987025910 24 Left 987025898 5:13926141-13926163 CCCCTGCTGAAAAGAGCCAGACT 0: 1
1: 0
2: 2
3: 23
4: 186
Right 987025910 5:13926188-13926210 AAGGAGCACCTGAGGGAGGATGG No data
987025903_987025910 -3 Left 987025903 5:13926168-13926190 CCACCTTAAATCCTACTCAAAAG 0: 1
1: 0
2: 4
3: 24
4: 174
Right 987025910 5:13926188-13926210 AAGGAGCACCTGAGGGAGGATGG No data
987025902_987025910 8 Left 987025902 5:13926157-13926179 CCAGACTGGAGCCACCTTAAATC 0: 1
1: 0
2: 0
3: 5
4: 77
Right 987025910 5:13926188-13926210 AAGGAGCACCTGAGGGAGGATGG No data
987025900_987025910 22 Left 987025900 5:13926143-13926165 CCTGCTGAAAAGAGCCAGACTGG 0: 1
1: 0
2: 1
3: 12
4: 231
Right 987025910 5:13926188-13926210 AAGGAGCACCTGAGGGAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987025910 Original CRISPR AAGGAGCACCTGAGGGAGGA TGG Intronic
No off target data available for this crispr