ID: 987026568

View in Genome Browser
Species Human (GRCh38)
Location 5:13932767-13932789
Sequence CTCTTGATGAACCCAGTGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 92}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987026568_987026570 17 Left 987026568 5:13932767-13932789 CCAGACACTGGGTTCATCAAGAG 0: 1
1: 0
2: 0
3: 4
4: 92
Right 987026570 5:13932807-13932829 ACAATCATAAGTTCAGCTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987026568 Original CRISPR CTCTTGATGAACCCAGTGTC TGG (reversed) Intronic
902989264 1:20174831-20174853 GTCTTGAGAAACCCAGGGTCGGG - Intronic
904824860 1:33267529-33267551 CTTTTAATGGATCCAGTGTCAGG + Intronic
905202740 1:36324650-36324672 CTCTACTTGAACCCAGTCTCGGG - Intronic
906590664 1:47021892-47021914 CTCATGAAGAACCCAGGGACCGG + Intergenic
909536860 1:76746708-76746730 CTATTGACCAACCCAGTGTAGGG - Intergenic
912565447 1:110584336-110584358 CTCTTGCTGAAGTCCGTGTCTGG + Intergenic
917159306 1:172039808-172039830 CTCTTCATGCACTCAGTGTCTGG + Intronic
919767228 1:201135266-201135288 GTCTTCAGGAACTCAGTGTCTGG - Exonic
923203916 1:231739623-231739645 CCCTTGAAGAACTCAGTGCCTGG - Intronic
924132648 1:240927964-240927986 CTCCTGATTAACCCTGAGTCTGG + Intronic
1074494384 10:113967037-113967059 CTCATGAAGAACCCAGGGACAGG + Intergenic
1079742572 11:24081414-24081436 CTTTTGATGTACCCAGTATTAGG + Intergenic
1080727003 11:34908354-34908376 CCCTTCCTGAGCCCAGTGTCAGG - Intronic
1081853284 11:46288680-46288702 CCCAGGATGAACCCAGTGTGTGG + Intronic
1083590552 11:63891466-63891488 CTCTTGGTGAACCGAGGGGCTGG - Intronic
1093231490 12:16549230-16549252 CTCTTCATGAAACAAGTGTAAGG + Intronic
1097489015 12:60240899-60240921 CTCAGGAAGACCCCAGTGTCTGG + Intergenic
1104063379 12:125286429-125286451 TCCTTGAAGAACCCAGAGTCAGG - Intronic
1108739099 13:53316708-53316730 CTCATTATGAACACAGTGCCAGG + Intergenic
1112496124 13:99906190-99906212 TTCTTGATGATCACAGTGACAGG - Intergenic
1114186778 14:20408596-20408618 CTCTGGATGAACCCAGTCCTGGG - Intronic
1115450412 14:33541367-33541389 CTGTTGGTGAACACAGTGTGTGG - Intronic
1121925660 14:97925090-97925112 CTATTGCAGAACCCAGGGTCTGG + Intergenic
1132317867 15:100902990-100903012 CTCTGGGTGAACCAAGTCTCAGG - Intronic
1138290389 16:55841676-55841698 CTCTTGATGAAGTCAATGCCTGG + Intergenic
1141460890 16:84178306-84178328 CTCTGCATGAGCTCAGTGTCAGG + Exonic
1148528173 17:48363200-48363222 TGCTTGATGAACCCAGCATCTGG - Intronic
1152375253 17:79915582-79915604 GTCTGGAGGAACCGAGTGTCAGG + Intergenic
1155311484 18:24528531-24528553 CACTTAATGAACACAGTTTCAGG - Intergenic
1159965762 18:74594790-74594812 GTCTTGATGAATCCACTGTCTGG - Intergenic
1160903843 19:1442846-1442868 CTCTTCTTTAATCCAGTGTCAGG + Intergenic
1161685503 19:5700772-5700794 ATCCTGGTGAGCCCAGTGTCTGG - Exonic
1161984654 19:7646823-7646845 CCTTTGGGGAACCCAGTGTCTGG - Intronic
1167297406 19:48659746-48659768 CTCCCGATGAACCCAGGGTGGGG - Intergenic
1168061167 19:53893080-53893102 CCCTTGAGGAAGCCAGGGTCTGG - Intronic
926962357 2:18372337-18372359 CTCCTAAAGAACCCAGTGTTAGG + Intergenic
936977546 2:118234707-118234729 CTCTTAATGAACACAGCCTCAGG + Intergenic
942108491 2:172656934-172656956 CTCTGGGTGAACCCAGTCTTAGG - Intergenic
1169777162 20:9268085-9268107 TTCTTTATAAACCCAGTTTCAGG + Intronic
1171067733 20:22035211-22035233 CTCTTGATGAGCTCAGCGTGTGG + Intergenic
1173461772 20:43248697-43248719 CTCCTGATGAAGCCTGGGTCCGG + Intergenic
1174682415 20:52421408-52421430 GTGTTAATGAGCCCAGTGTCTGG + Intergenic
1175812496 20:61866039-61866061 CCCTTGATGACCTCAGTGCCAGG - Intronic
1179154138 21:38835171-38835193 CTCTTGATGGAAACAGTGTTTGG - Intergenic
1182251427 22:29004082-29004104 CTCTTGAGGAAGGCAGTGTTTGG - Intronic
1185024545 22:48400941-48400963 CTCTTTAAGAATCCAGTGTGAGG + Intergenic
951193234 3:19794962-19794984 CTCTTGATGAAATCATAGTCTGG - Intergenic
951810232 3:26690367-26690389 CTCTTGGTGAACCAAATGGCAGG - Intronic
952836575 3:37607485-37607507 CTCTTCTGGAATCCAGTGTCTGG + Intronic
954670324 3:52287743-52287765 CTCTGGCTGAAGCCGGTGTCCGG - Intronic
956165792 3:66397269-66397291 CTCTTGATGAACCCTCAGTTGGG - Intronic
956643924 3:71438182-71438204 CTCTTTAAGAACACTGTGTCTGG + Intronic
957618715 3:82567310-82567332 CTTTGCATGAAGCCAGTGTCTGG + Intergenic
960057741 3:113287202-113287224 CTCGTGATGAACCATGTGCCTGG - Exonic
963513235 3:146275667-146275689 GTTTTGATGAACACAGTGTTAGG - Intergenic
964589065 3:158340645-158340667 CTCTTTCTGTTCCCAGTGTCGGG + Intronic
965572654 3:170187188-170187210 CTCTGAAAGAACCCAGTGTAGGG - Intergenic
972928512 4:44041255-44041277 CTCTGGATGTGCCCAGTGCCTGG + Intergenic
974068752 4:57104989-57105011 CTCCTTATAAACACAGTGTCTGG - Intronic
974566579 4:63584472-63584494 TTCTTTATAAACCCAGTGTCTGG + Intergenic
975586127 4:75951604-75951626 ATCTTGAAGAACCCAGCCTCTGG - Intronic
981875151 4:149533530-149533552 TTCTTTATGTACCCAGTCTCGGG - Intergenic
985956727 5:3271230-3271252 CTCTGGATGAACGAAGTGTGTGG - Intergenic
987026568 5:13932767-13932789 CTCTTGATGAACCCAGTGTCTGG - Intronic
988894098 5:35653533-35653555 CTATTGATAACCCAAGTGTCAGG - Intronic
989172520 5:38486849-38486871 CTTTTGATGAATTCAGTGTTTGG + Intronic
991576520 5:68109743-68109765 CTGGCAATGAACCCAGTGTCAGG - Intergenic
994221590 5:97201757-97201779 CTCATGATGATACCAGGGTCAGG - Intergenic
996175746 5:120354585-120354607 TACTTTATGAACCCAGTGTAAGG + Intergenic
996429897 5:123362384-123362406 CTTTTGATGAATCCAGCCTCAGG - Intronic
996666634 5:126067126-126067148 CTCTGGATACACCCAGGGTCTGG + Intergenic
996713864 5:126570479-126570501 ACCTTGATAAACCAAGTGTCAGG + Intronic
1013016957 6:106168579-106168601 CTCTTCATGATCCCAGCGCCAGG - Intergenic
1013524174 6:110959056-110959078 CTCTTGCTGAAAACAGGGTCCGG + Intronic
1014946272 6:127502366-127502388 CTGTTGATGAATGCAGTGGCAGG + Intronic
1015583841 6:134755699-134755721 CTCTTGTTGCACCCTGTGTAAGG - Intergenic
1018918096 6:168150390-168150412 CTGTTGATGAAGCCACTGTAGGG - Intergenic
1023540588 7:41261194-41261216 CTCTTGATAAACATAGTGTTGGG + Intergenic
1026582601 7:71630725-71630747 CTCTTGCTGAATTCAGTCTCTGG - Intronic
1031058615 7:117023376-117023398 ATATTGATGAAAGCAGTGTCAGG - Intronic
1032804186 7:135339270-135339292 CTGGTCCTGAACCCAGTGTCTGG - Intergenic
1034357751 7:150466067-150466089 CTCGTGATGCACCCAGTGCCAGG - Intronic
1037797402 8:22007931-22007953 GACTTGATGAACACAGTGCCTGG - Intergenic
1038066223 8:23966336-23966358 CTCTTAAGCCACCCAGTGTCTGG + Intergenic
1040468080 8:47713749-47713771 TTCTTTATGTATCCAGTGTCTGG - Intronic
1048224129 8:132568330-132568352 CTCTTGATGGAAGGAGTGTCCGG + Intergenic
1051504426 9:17812078-17812100 CTCTTGCTGAATCCTCTGTCTGG - Intergenic
1061511670 9:131065134-131065156 ATCTACATGAAACCAGTGTCAGG - Intronic
1061778982 9:132984796-132984818 CTCTTGATGCCCCCAGGCTCTGG + Intronic
1203534720 Un_KI270743v1:23355-23377 ATCTTGGATAACCCAGTGTCTGG + Intergenic
1186798169 X:13066708-13066730 CTCTTCCTGAACCCTCTGTCTGG + Intergenic
1188520379 X:31031994-31032016 CTTCTGATGAACCCAGGGGCAGG + Intergenic
1193016460 X:76739117-76739139 CTCTGGATGAACCCAGGCTGGGG + Intergenic
1193409085 X:81141207-81141229 CTCTGGATTCACCCAGTGCCTGG + Intronic
1195563838 X:106318827-106318849 TCTTTGATAAACCCAGTGTCTGG - Intergenic
1196508353 X:116476187-116476209 CTCTTGATCAACCCAAGGCCAGG - Intergenic
1197263898 X:124346371-124346393 CTCTGTATGAACCCTGTGTTGGG + Exonic