ID: 987029477

View in Genome Browser
Species Human (GRCh38)
Location 5:13962795-13962817
Sequence GAACCCAGCTAGTCAAAAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987029470_987029477 17 Left 987029470 5:13962755-13962777 CCTACTAAAACTGGGCTTGGCAG No data
Right 987029477 5:13962795-13962817 GAACCCAGCTAGTCAAAAAGAGG No data
987029475_987029477 -7 Left 987029475 5:13962779-13962801 CCAAGGACAGGGCCAAGAACCCA No data
Right 987029477 5:13962795-13962817 GAACCCAGCTAGTCAAAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987029477 Original CRISPR GAACCCAGCTAGTCAAAAAG AGG Intergenic
No off target data available for this crispr