ID: 987037578

View in Genome Browser
Species Human (GRCh38)
Location 5:14033452-14033474
Sequence CTGTAGATACAGCTGGTCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987037578_987037581 -4 Left 987037578 5:14033452-14033474 CCCAGGACCAGCTGTATCTACAG No data
Right 987037581 5:14033471-14033493 ACAGTACCTAGAACCATGCCTGG No data
987037578_987037586 28 Left 987037578 5:14033452-14033474 CCCAGGACCAGCTGTATCTACAG No data
Right 987037586 5:14033503-14033525 GGCACCCAATACATATTTGATGG No data
987037578_987037583 7 Left 987037578 5:14033452-14033474 CCCAGGACCAGCTGTATCTACAG No data
Right 987037583 5:14033482-14033504 AACCATGCCTGGCATACAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987037578 Original CRISPR CTGTAGATACAGCTGGTCCT GGG (reversed) Intergenic
No off target data available for this crispr