ID: 987037682

View in Genome Browser
Species Human (GRCh38)
Location 5:14034711-14034733
Sequence CTAAGCCTTAGTTGCTGATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987037682_987037686 1 Left 987037682 5:14034711-14034733 CCATATCAGCAACTAAGGCTTAG No data
Right 987037686 5:14034735-14034757 GCGGTTGGGTAATTTGCTCAAGG No data
987037682_987037687 9 Left 987037682 5:14034711-14034733 CCATATCAGCAACTAAGGCTTAG No data
Right 987037687 5:14034743-14034765 GTAATTTGCTCAAGGTCTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987037682 Original CRISPR CTAAGCCTTAGTTGCTGATA TGG (reversed) Intergenic
No off target data available for this crispr