ID: 987046716

View in Genome Browser
Species Human (GRCh38)
Location 5:14115806-14115828
Sequence GGGAGTTGCCCAGCCTAGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987046716_987046718 -7 Left 987046716 5:14115806-14115828 CCACACTAGGCTGGGCAACTCCC No data
Right 987046718 5:14115822-14115844 AACTCCCCCATGCTCCTCATGGG No data
987046716_987046725 18 Left 987046716 5:14115806-14115828 CCACACTAGGCTGGGCAACTCCC No data
Right 987046725 5:14115847-14115869 TCCTAACCCATTCCACCCTCTGG No data
987046716_987046717 -8 Left 987046716 5:14115806-14115828 CCACACTAGGCTGGGCAACTCCC No data
Right 987046717 5:14115821-14115843 CAACTCCCCCATGCTCCTCATGG No data
987046716_987046727 19 Left 987046716 5:14115806-14115828 CCACACTAGGCTGGGCAACTCCC No data
Right 987046727 5:14115848-14115870 CCTAACCCATTCCACCCTCTGGG No data
987046716_987046719 -6 Left 987046716 5:14115806-14115828 CCACACTAGGCTGGGCAACTCCC No data
Right 987046719 5:14115823-14115845 ACTCCCCCATGCTCCTCATGGGG No data
987046716_987046728 23 Left 987046716 5:14115806-14115828 CCACACTAGGCTGGGCAACTCCC No data
Right 987046728 5:14115852-14115874 ACCCATTCCACCCTCTGGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987046716 Original CRISPR GGGAGTTGCCCAGCCTAGTG TGG (reversed) Intergenic
No off target data available for this crispr