ID: 987046722

View in Genome Browser
Species Human (GRCh38)
Location 5:14115828-14115850
Sequence AGGAGCCCCATGAGGAGCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987046722_987046727 -3 Left 987046722 5:14115828-14115850 CCCATGCTCCTCATGGGGCTCCT No data
Right 987046727 5:14115848-14115870 CCTAACCCATTCCACCCTCTGGG No data
987046722_987046734 22 Left 987046722 5:14115828-14115850 CCCATGCTCCTCATGGGGCTCCT No data
Right 987046734 5:14115873-14115895 GGTCTTTTCCACCAGTAGAAAGG No data
987046722_987046725 -4 Left 987046722 5:14115828-14115850 CCCATGCTCCTCATGGGGCTCCT No data
Right 987046725 5:14115847-14115869 TCCTAACCCATTCCACCCTCTGG No data
987046722_987046728 1 Left 987046722 5:14115828-14115850 CCCATGCTCCTCATGGGGCTCCT No data
Right 987046728 5:14115852-14115874 ACCCATTCCACCCTCTGGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987046722 Original CRISPR AGGAGCCCCATGAGGAGCAT GGG (reversed) Intergenic
No off target data available for this crispr