ID: 987046727

View in Genome Browser
Species Human (GRCh38)
Location 5:14115848-14115870
Sequence CCTAACCCATTCCACCCTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987046722_987046727 -3 Left 987046722 5:14115828-14115850 CCCATGCTCCTCATGGGGCTCCT No data
Right 987046727 5:14115848-14115870 CCTAACCCATTCCACCCTCTGGG No data
987046720_987046727 -1 Left 987046720 5:14115826-14115848 CCCCCATGCTCCTCATGGGGCTC No data
Right 987046727 5:14115848-14115870 CCTAACCCATTCCACCCTCTGGG No data
987046723_987046727 -4 Left 987046723 5:14115829-14115851 CCATGCTCCTCATGGGGCTCCTA No data
Right 987046727 5:14115848-14115870 CCTAACCCATTCCACCCTCTGGG No data
987046721_987046727 -2 Left 987046721 5:14115827-14115849 CCCCATGCTCCTCATGGGGCTCC No data
Right 987046727 5:14115848-14115870 CCTAACCCATTCCACCCTCTGGG No data
987046716_987046727 19 Left 987046716 5:14115806-14115828 CCACACTAGGCTGGGCAACTCCC No data
Right 987046727 5:14115848-14115870 CCTAACCCATTCCACCCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987046727 Original CRISPR CCTAACCCATTCCACCCTCT GGG Intergenic
No off target data available for this crispr