ID: 987046728

View in Genome Browser
Species Human (GRCh38)
Location 5:14115852-14115874
Sequence ACCCATTCCACCCTCTGGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987046721_987046728 2 Left 987046721 5:14115827-14115849 CCCCATGCTCCTCATGGGGCTCC No data
Right 987046728 5:14115852-14115874 ACCCATTCCACCCTCTGGGTTGG No data
987046722_987046728 1 Left 987046722 5:14115828-14115850 CCCATGCTCCTCATGGGGCTCCT No data
Right 987046728 5:14115852-14115874 ACCCATTCCACCCTCTGGGTTGG No data
987046716_987046728 23 Left 987046716 5:14115806-14115828 CCACACTAGGCTGGGCAACTCCC No data
Right 987046728 5:14115852-14115874 ACCCATTCCACCCTCTGGGTTGG No data
987046723_987046728 0 Left 987046723 5:14115829-14115851 CCATGCTCCTCATGGGGCTCCTA No data
Right 987046728 5:14115852-14115874 ACCCATTCCACCCTCTGGGTTGG No data
987046720_987046728 3 Left 987046720 5:14115826-14115848 CCCCCATGCTCCTCATGGGGCTC No data
Right 987046728 5:14115852-14115874 ACCCATTCCACCCTCTGGGTTGG No data
987046724_987046728 -7 Left 987046724 5:14115836-14115858 CCTCATGGGGCTCCTAACCCATT No data
Right 987046728 5:14115852-14115874 ACCCATTCCACCCTCTGGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987046728 Original CRISPR ACCCATTCCACCCTCTGGGT TGG Intergenic
No off target data available for this crispr