ID: 987047919

View in Genome Browser
Species Human (GRCh38)
Location 5:14124828-14124850
Sequence AAAAAAATGGAGAAGGAGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987047915_987047919 25 Left 987047915 5:14124780-14124802 CCTAAGCATGTGAGTTTCTACTC No data
Right 987047919 5:14124828-14124850 AAAAAAATGGAGAAGGAGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987047919 Original CRISPR AAAAAAATGGAGAAGGAGGC CGG Intergenic
No off target data available for this crispr