ID: 987048640

View in Genome Browser
Species Human (GRCh38)
Location 5:14130704-14130726
Sequence CTTTCAGTACTGAATGTGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987048640_987048646 -4 Left 987048640 5:14130704-14130726 CCCGCCACATTCAGTACTGAAAG No data
Right 987048646 5:14130723-14130745 AAAGAGAAAAGGGACAATGGTGG No data
987048640_987048645 -7 Left 987048640 5:14130704-14130726 CCCGCCACATTCAGTACTGAAAG No data
Right 987048645 5:14130720-14130742 CTGAAAGAGAAAAGGGACAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987048640 Original CRISPR CTTTCAGTACTGAATGTGGC GGG (reversed) Intergenic
No off target data available for this crispr