ID: 987050337

View in Genome Browser
Species Human (GRCh38)
Location 5:14143327-14143349
Sequence ATTTCAATGGGGAAGGAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987050337_987050347 20 Left 987050337 5:14143327-14143349 CCTCCTTCCTTCCCCATTGAAAT No data
Right 987050347 5:14143370-14143392 GCCGCCGGCGCCCGTGATCCCGG No data
987050337_987050346 5 Left 987050337 5:14143327-14143349 CCTCCTTCCTTCCCCATTGAAAT No data
Right 987050346 5:14143355-14143377 TGGAGGCTCGCGGCAGCCGCCGG No data
987050337_987050345 -5 Left 987050337 5:14143327-14143349 CCTCCTTCCTTCCCCATTGAAAT No data
Right 987050345 5:14143345-14143367 GAAATCAAGATGGAGGCTCGCGG No data
987050337_987050349 23 Left 987050337 5:14143327-14143349 CCTCCTTCCTTCCCCATTGAAAT No data
Right 987050349 5:14143373-14143395 GCCGGCGCCCGTGATCCCGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987050337 Original CRISPR ATTTCAATGGGGAAGGAAGG AGG (reversed) Intergenic
No off target data available for this crispr