ID: 987050590

View in Genome Browser
Species Human (GRCh38)
Location 5:14144175-14144197
Sequence CCCGGCAGCCGCGGCTTCGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 227
Summary {0: 1, 1: 1, 2: 0, 3: 18, 4: 207}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987050575_987050590 18 Left 987050575 5:14144134-14144156 CCCGCCCCTCGTTTTAGGGCAGA 0: 1
1: 0
2: 0
3: 6
4: 89
Right 987050590 5:14144175-14144197 CCCGGCAGCCGCGGCTTCGCGGG 0: 1
1: 1
2: 0
3: 18
4: 207
987050570_987050590 28 Left 987050570 5:14144124-14144146 CCTCCCTGCGCCCGCCCCTCGTT 0: 1
1: 0
2: 1
3: 24
4: 279
Right 987050590 5:14144175-14144197 CCCGGCAGCCGCGGCTTCGCGGG 0: 1
1: 1
2: 0
3: 18
4: 207
987050572_987050590 24 Left 987050572 5:14144128-14144150 CCTGCGCCCGCCCCTCGTTTTAG 0: 1
1: 0
2: 0
3: 2
4: 53
Right 987050590 5:14144175-14144197 CCCGGCAGCCGCGGCTTCGCGGG 0: 1
1: 1
2: 0
3: 18
4: 207
987050577_987050590 14 Left 987050577 5:14144138-14144160 CCCCTCGTTTTAGGGCAGAATCC 0: 1
1: 0
2: 0
3: 2
4: 59
Right 987050590 5:14144175-14144197 CCCGGCAGCCGCGGCTTCGCGGG 0: 1
1: 1
2: 0
3: 18
4: 207
987050583_987050590 -8 Left 987050583 5:14144160-14144182 CCCCGGTCTGCCGCTCCCGGCAG 0: 1
1: 0
2: 0
3: 12
4: 142
Right 987050590 5:14144175-14144197 CCCGGCAGCCGCGGCTTCGCGGG 0: 1
1: 1
2: 0
3: 18
4: 207
987050585_987050590 -10 Left 987050585 5:14144162-14144184 CCGGTCTGCCGCTCCCGGCAGCC 0: 1
1: 1
2: 0
3: 11
4: 213
Right 987050590 5:14144175-14144197 CCCGGCAGCCGCGGCTTCGCGGG 0: 1
1: 1
2: 0
3: 18
4: 207
987050584_987050590 -9 Left 987050584 5:14144161-14144183 CCCGGTCTGCCGCTCCCGGCAGC 0: 1
1: 0
2: 0
3: 17
4: 206
Right 987050590 5:14144175-14144197 CCCGGCAGCCGCGGCTTCGCGGG 0: 1
1: 1
2: 0
3: 18
4: 207
987050569_987050590 29 Left 987050569 5:14144123-14144145 CCCTCCCTGCGCCCGCCCCTCGT 0: 1
1: 0
2: 2
3: 27
4: 469
Right 987050590 5:14144175-14144197 CCCGGCAGCCGCGGCTTCGCGGG 0: 1
1: 1
2: 0
3: 18
4: 207
987050571_987050590 25 Left 987050571 5:14144127-14144149 CCCTGCGCCCGCCCCTCGTTTTA 0: 1
1: 0
2: 0
3: 4
4: 49
Right 987050590 5:14144175-14144197 CCCGGCAGCCGCGGCTTCGCGGG 0: 1
1: 1
2: 0
3: 18
4: 207
987050578_987050590 13 Left 987050578 5:14144139-14144161 CCCTCGTTTTAGGGCAGAATCCC 0: 1
1: 0
2: 0
3: 5
4: 83
Right 987050590 5:14144175-14144197 CCCGGCAGCCGCGGCTTCGCGGG 0: 1
1: 1
2: 0
3: 18
4: 207
987050576_987050590 17 Left 987050576 5:14144135-14144157 CCGCCCCTCGTTTTAGGGCAGAA 0: 1
1: 0
2: 0
3: 3
4: 70
Right 987050590 5:14144175-14144197 CCCGGCAGCCGCGGCTTCGCGGG 0: 1
1: 1
2: 0
3: 18
4: 207
987050582_987050590 -7 Left 987050582 5:14144159-14144181 CCCCCGGTCTGCCGCTCCCGGCA 0: 1
1: 0
2: 2
3: 19
4: 138
Right 987050590 5:14144175-14144197 CCCGGCAGCCGCGGCTTCGCGGG 0: 1
1: 1
2: 0
3: 18
4: 207
987050579_987050590 12 Left 987050579 5:14144140-14144162 CCTCGTTTTAGGGCAGAATCCCC 0: 1
1: 0
2: 0
3: 7
4: 58
Right 987050590 5:14144175-14144197 CCCGGCAGCCGCGGCTTCGCGGG 0: 1
1: 1
2: 0
3: 18
4: 207

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987050590 Original CRISPR CCCGGCAGCCGCGGCTTCGC GGG Intronic
900513376 1:3070447-3070469 CGCTGCAGCCGGGGCTTCGGCGG - Intronic
901109635 1:6784924-6784946 CGCGCCAGCAGCGGCTTCCCCGG + Intergenic
901443537 1:9293315-9293337 CCCTGCAGCGGCGGCAGCGCGGG - Intronic
901606499 1:10463319-10463341 CCCAGCAGCCGCGGCTTCAGTGG + Intronic
903415222 1:23177777-23177799 CCCGGCACCGGCGGCTTCCCAGG - Exonic
903475687 1:23617793-23617815 CACGGCAACCTCCGCTTCGCGGG + Intronic
903907587 1:26697125-26697147 GCCGGCAGCCGCCGCCGCGCCGG - Exonic
904731493 1:32595723-32595745 CACTGCAGCCGCGACTTCTCAGG + Intronic
905169130 1:36099249-36099271 CAGGGCAGCCGGGGCTTCGGGGG - Exonic
905287553 1:36892092-36892114 CACGGCAGCCTCCGCTTCCCGGG + Intronic
907012699 1:50978127-50978149 CCCGGGAGCTGCGGGTTCCCCGG + Intergenic
909144345 1:71910771-71910793 CACTGCAGCCTCGGCTTCGCAGG + Intronic
910759001 1:90717597-90717619 CCCGGCAGCGGCGGCGGCGGCGG - Intergenic
911208592 1:95117449-95117471 CCCGGAACCCGCGGCTTCCCTGG + Exonic
913131089 1:115838875-115838897 CCCGGCAGCCGCGGCGCCCGAGG + Exonic
913216385 1:116624126-116624148 CACGGCAGCCTCGGCCTCCCAGG - Intronic
915070419 1:153261385-153261407 TCCGGCGGCGGCGGCTTCTCGGG + Exonic
917843582 1:179002360-179002382 CACTGCAGCCTCGGCTTCCCAGG - Intergenic
922562399 1:226578741-226578763 CCCTGCAGCGGCTGCTTCCCTGG + Intronic
924799163 1:247314820-247314842 CACGGCAACCGCTGCTTCCCAGG + Intronic
1062774569 10:135097-135119 AGCGGCTGCCGCGGCTTCGCGGG + Intronic
1063744174 10:8860994-8861016 CCCTGCAGCCTCGGCCTCCCAGG + Intergenic
1066126322 10:32346577-32346599 CCCGGCCGCCGCGGCCCAGCGGG - Intronic
1067028703 10:42866120-42866142 CCCGGCCGCCGCGAGCTCGCGGG + Intergenic
1067090017 10:43261730-43261752 CTGGGCAGCCCCGGCTTTGCTGG - Intronic
1067831759 10:49614600-49614622 CCCGACGGCCGCTGCTGCGCAGG - Intronic
1068788400 10:61001588-61001610 CCCGGCAGCCGCCGCCCTGCGGG + Intergenic
1069820423 10:71224134-71224156 CCCAGCAGCCCCGGCTTTCCTGG - Intronic
1069820444 10:71224270-71224292 CCCAGCAGCCCCGGCTTTCCTGG - Intronic
1070800834 10:79243559-79243581 CCCGGCGGCGGCGGCGGCGCGGG - Intronic
1072294208 10:93993910-93993932 CCGGACAGCGGCGGCTGCGCGGG - Intergenic
1072555982 10:96513894-96513916 CCCGGCGGCCGAGGCTGCGGCGG + Exonic
1073535008 10:104268845-104268867 GCCGGCAGCCGGGGCTTTGGTGG - Intergenic
1076221205 10:128734495-128734517 CCCGGCAGCCCCAGGTTCACTGG + Intergenic
1076374025 10:129971783-129971805 CCCGGGATCCGCGGCTCCGTCGG - Intergenic
1076899425 10:133330039-133330061 CCGGGCACCCTCGGCTTCTCTGG - Intronic
1077062050 11:621783-621805 CCCAGTCCCCGCGGCTTCGCTGG + Intronic
1078210431 11:9265466-9265488 CCCGCCGGCCGCAGCTTCCCGGG + Intergenic
1080609714 11:33893252-33893274 CACGCCTGCCGCGGCTGCGCCGG + Intergenic
1082066551 11:47905533-47905555 CCGGGCGGCCACGGCTTTGCTGG + Intergenic
1083039126 11:59669080-59669102 CCCGGCGGCGGCGGCTGCGCAGG + Intergenic
1083877027 11:65529627-65529649 CCCCATAGCCGCGGCTTGGCCGG - Intronic
1084129036 11:67119340-67119362 CCCGGCAGCGGCGGCGGCGGCGG + Intronic
1086900896 11:92366514-92366536 CTCGGCAGCCGCAGCTTCCATGG + Intronic
1090807548 11:130211871-130211893 CCTGGCAGCCGGGGCTTGGCCGG + Intergenic
1095983596 12:47985937-47985959 CCCGGCAACCGCGGTTTCCCAGG - Exonic
1096101236 12:48971609-48971631 CCCGGCGGCCGCGGCGGCGCTGG - Exonic
1097676161 12:62603847-62603869 GCCGGGCGCCGAGGCTTCGCGGG - Intergenic
1102253961 12:111405731-111405753 CCTGGCAGCCGCGGACTAGCGGG + Intergenic
1103949696 12:124544063-124544085 CCGGGCAGAGGCGGCGTCGCTGG - Intronic
1103954252 12:124567589-124567611 CCCGGCGGCCGCGGCGGCGGTGG + Intronic
1107604032 13:42040814-42040836 CCCCGCCGCCGCCGCTGCGCCGG - Intronic
1108541495 13:51451732-51451754 CCCGGCAGCGGCGGCGGCGGCGG - Intronic
1110572938 13:77026538-77026560 CCCGGGAGCGGCGGCGTCGCGGG + Intronic
1112012150 13:95301442-95301464 CCCGGAAGCGGCTGCTTCACAGG - Intergenic
1113254841 13:108495692-108495714 ACCCGCAGCCGCGGCGTCGGCGG - Intergenic
1121424616 14:93840748-93840770 CACTGCAGCCTCGGCTTCCCAGG + Intergenic
1122418188 14:101560387-101560409 CCCAGCGGCCGGGGCTGCGCTGG + Intergenic
1122690334 14:103529240-103529262 CCCGGCAGCAGGAGCGTCGCAGG + Exonic
1124328120 15:28784250-28784272 CCCCGCAGCCTCGGCCTCCCAGG + Intergenic
1125605265 15:40936642-40936664 TGCGGCAGCTGCGGCTTCGACGG + Exonic
1127071262 15:55289950-55289972 CCCGGCGGCCGCGCCTCCGAGGG + Intronic
1127868182 15:63048491-63048513 CCCGGCTGCCGCGGCTGTCCTGG - Intronic
1128269139 15:66293562-66293584 CCCGGCGGCCGCGGAGTGGCGGG - Exonic
1129082567 15:73052990-73053012 CCCGGCAGCCGCCCCTTCCCCGG - Intronic
1130336135 15:82958745-82958767 CCCAGCAGCTGCAGCTTCCCAGG - Intronic
1132584646 16:700891-700913 CCCGGCAGCCCCCGCTCAGCAGG + Intronic
1132765189 16:1530939-1530961 CCCAGCAGCCTCGGCCTGGCAGG - Intronic
1139510749 16:67427222-67427244 CCCGGCAGCCGTGGCTTCGCAGG + Intergenic
1141874625 16:86814772-86814794 CACTGCAGCCTCCGCTTCGCAGG + Intergenic
1142083811 16:88165303-88165325 CCGGGTAGCCGAGGCTTCTCTGG + Intergenic
1142225779 16:88877033-88877055 CCCCGCAGAGCCGGCTTCGCTGG + Exonic
1142328516 16:89434456-89434478 CCTGGCTGCAGCGACTTCGCTGG - Intronic
1142810556 17:2393789-2393811 CCCTGCAGCCTCGGCGTCCCCGG - Intronic
1145385515 17:22409223-22409245 AGCCGCAGCCGCGGCTGCGCAGG + Intergenic
1145765508 17:27456259-27456281 CCCGGCGGCCGCGGCGAGGCAGG - Intergenic
1149685376 17:58531849-58531871 CACCGCAGCCGCGGCTGTGCAGG - Intronic
1149915035 17:60600651-60600673 CCCGGACGCCGGGGCCTCGCCGG + Exonic
1150132599 17:62677385-62677407 CCCGGCAGCTCCGGCGTCACTGG - Exonic
1151674092 17:75589098-75589120 CCCGCCAGGCGCCGCTTCCCAGG + Intergenic
1151820684 17:76495139-76495161 CCCGGCAGCCGGGTTTTCACGGG + Intronic
1152246657 17:79188118-79188140 CCTGGCAGGCGAGGCCTCGCTGG + Intronic
1152407286 17:80104920-80104942 CCCTGCAGCCCCTGCTTTGCAGG - Intergenic
1152714533 17:81892057-81892079 TCCGGCGGGCGCGGCTTCGGCGG + Intronic
1153202791 18:2663179-2663201 CACTGCAGCCTCGGCTTCCCAGG + Intronic
1153911208 18:9708133-9708155 CCCGGGACCTGCGGCGTCGCCGG - Intergenic
1157095146 18:44680367-44680389 CCCGGCGGCTCCGGCTCCGCTGG - Intronic
1160514820 18:79472422-79472444 CCCGGCAGCCTCTCCTTCCCAGG + Intronic
1160594428 18:79964270-79964292 CCCCGCAGCCTCGACTTCCCGGG - Intergenic
1160662798 19:308827-308849 CCCAGCAGACGCGGCTGGGCCGG - Exonic
1160853537 19:1206017-1206039 CCCGGCGGCCGAGGCGGCGCAGG - Intronic
1160910345 19:1471076-1471098 CTCGCCCGCCGCGGCTGCGCCGG - Exonic
1160921800 19:1524146-1524168 CCCGGCCGCGGCGGCGGCGCAGG + Intronic
1161027189 19:2042148-2042170 CCCGGCAGCCGCTGATTGGTCGG - Intronic
1161318642 19:3631101-3631123 CCCGGCCGACGCGCCTTTGCAGG - Exonic
1161388472 19:4009097-4009119 CCCGGAAGCCGTGGCCTTGCGGG - Intronic
1161491820 19:4566574-4566596 TCCGGCAGCCGCAGCGTGGCAGG - Intergenic
1161808759 19:6459655-6459677 CCCGGCAGCGGCGGCCTCAGTGG + Exonic
1162607054 19:11717361-11717383 CACTGCAGCCTCGGCTTCCCTGG + Intergenic
1162925888 19:13930370-13930392 CCCAGCTGCAGCGGCTCCGCAGG + Exonic
1163128220 19:15255932-15255954 CTCTGCAGCCGTGGCTTCACAGG - Intronic
1164834535 19:31349245-31349267 CCCGGCAGCGGCGGCGGCGGCGG - Exonic
1165213788 19:34254888-34254910 CTCGGCGGCCGCGGCACCGCAGG + Intronic
1166092382 19:40518506-40518528 CACTGCAGCCTCGACTTCGCAGG + Intronic
1166276706 19:41758854-41758876 CCCGGCAGGGGCGGCTGCTCCGG - Intronic
1166984148 19:46649582-46649604 CCCGGCGGCGGCGCCTGCGCAGG + Exonic
1168230908 19:55030922-55030944 CCCTGCAGCCTCGGCCTCCCTGG + Intronic
1168414503 19:56159905-56159927 CCCGGCAGCCCCGGCAGCCCCGG + Exonic
927215846 2:20667425-20667447 CCCGGCCGCCGCGGTTCCCCGGG + Exonic
927971161 2:27307040-27307062 CCCCGCAGCCTGGGCTTCGAAGG + Exonic
931695170 2:64865702-64865724 CCAGGCGGCCGCGGCCTCGGCGG + Intergenic
933514037 2:83278145-83278167 CCCTGCAGCCTCGACTTCCCAGG - Intergenic
933655217 2:84881154-84881176 CCCGGCAGCAGCGGCCACGTGGG + Exonic
935717204 2:105949820-105949842 CACTGCAGCCTCGGCTTCCCAGG - Intergenic
936943891 2:117913648-117913670 CCCTGCAGCCTCGACTTCCCAGG + Intergenic
938548034 2:132352920-132352942 CCCGGCGGCGGCGGCTGCACAGG + Intergenic
940482774 2:154255975-154255997 CCCTGCAGCCTCGACTTCCCAGG - Intronic
942712019 2:178847453-178847475 CACGGCAGCCTCGACTTCCCAGG - Intronic
944632773 2:201643457-201643479 CCCGGAGGCCGCTGCGTCGCGGG - Exonic
945999810 2:216472277-216472299 CACTGCAGCCGCTGCTTCCCAGG - Intronic
946896903 2:224333247-224333269 CACGGCAGCCTCGACTTCCCGGG - Intergenic
947506656 2:230713049-230713071 CGCGGCGGCGGCGGCTGCGCGGG - Exonic
948613022 2:239181430-239181452 CCCGGCAGCAGCGTGTGCGCAGG + Intronic
948890988 2:240907025-240907047 CCTGGCAGCCACGGGTTTGCAGG + Intergenic
1169211399 20:3767919-3767941 CCCGGCAGGCGCGGACTAGCAGG - Intronic
1171876903 20:30585692-30585714 CCCGGCGGCGGCGGCTGCACAGG + Intergenic
1172359610 20:34303004-34303026 CGCGGCGGCCCCGGCGTCGCGGG + Intronic
1172487067 20:35304743-35304765 CCCTGCAGCAGTGGCTTCTCTGG - Intronic
1173704175 20:45098010-45098032 CACGGCGGCCGCCGCCTCGCGGG + Exonic
1175873735 20:62220048-62220070 CCCGGGAGCCTCGTCTTTGCGGG + Exonic
1175926777 20:62475196-62475218 CCCGGCAGCGGCGGCAGCGCGGG - Exonic
1176552676 21:8235712-8235734 CCCTGCAGCCTCCGCTTCCCTGG - Intergenic
1176571574 21:8418115-8418137 CCCTGCAGCCTCCGCTTCCCTGG - Intergenic
1176579486 21:8462678-8462700 CCCTGCAGCCTCCGCTTCCCTGG - Intergenic
1179209495 21:39313383-39313405 CCCGGCTGCTTCGGCTTCCCCGG - Intronic
1179948727 21:44697864-44697886 CCAGGCGGCCGCAGCTTGGCTGG - Exonic
1179953652 21:44725720-44725742 CCCTGCAGCCTCTGCTTCCCGGG - Intergenic
1180089397 21:45526056-45526078 CCCGGCAGCCACGGGGTCCCAGG + Intronic
1180558956 22:16601085-16601107 GAGGGCAGCCGGGGCTTCGCTGG - Intergenic
1180891377 22:19291550-19291572 CCTGTCAGCCGCGCCTCCGCCGG - Intronic
1184004752 22:41699865-41699887 CCCGGCCGCAGCGGCCTCTCGGG + Intronic
1184536447 22:45090706-45090728 ATCGGCAGCCGTGGCTTCTCAGG - Intergenic
1185278621 22:49960653-49960675 CCCGGCCGCCGCCGCCTCGCGGG + Exonic
949970240 3:9397671-9397693 CCCGGCAGCGGCGGCGGCGGCGG - Intronic
950107657 3:10398515-10398537 CCCAGCAGCCCAGGCTTCACGGG + Intronic
950443545 3:13023344-13023366 CCAGGCAGCTGGGGCTTCCCAGG + Intronic
950729828 3:14947766-14947788 CCCGGGGGCCGCGGGCTCGCGGG - Intronic
951080307 3:18444737-18444759 CGCGGCAGCCGCAGCTCCGGCGG - Intronic
954259771 3:49430207-49430229 CACTGCAGCCTCGACTTCGCGGG + Intergenic
954277877 3:49554390-49554412 CCCGCCAGCCTCGGGGTCGCTGG - Intergenic
960004791 3:112770918-112770940 CACTGCAACCGCGGCTTCCCGGG - Intronic
965519880 3:169661677-169661699 CTCAGCAGGCTCGGCTTCGCGGG - Intronic
968299093 3:197599726-197599748 CCAGGCAGCCCCGGCTACGATGG - Intergenic
968462717 4:733285-733307 CCCGGCAGCTCTGCCTTCGCGGG + Intronic
968512685 4:1002542-1002564 CCCCGCAGCGGGGCCTTCGCAGG - Intronic
972265334 4:37453980-37454002 CCCGGCGCCCATGGCTTCGCCGG - Intronic
972670972 4:41214053-41214075 CTCAGCAGCCCCGGCTTGGCAGG - Intronic
975986254 4:80203226-80203248 CGCTGCAGCCGCGGCTGCGGCGG + Exonic
976775769 4:88704315-88704337 CCAGGCTGCTGCTGCTTCGCCGG - Intronic
984715050 4:182917424-182917446 CCCGGGCGCCGCGCGTTCGCAGG + Intronic
985420078 4:189776495-189776517 CACTGCAGCCTCGGCTTCCCGGG + Intergenic
985445399 4:190018816-190018838 CCGGGCAGCCCTGGCTTCTCTGG + Intergenic
985782154 5:1876915-1876937 CCGGCGAGCCGCGGCTCCGCGGG - Intergenic
986233314 5:5886035-5886057 CCCGGTAGCCCCAGCATCGCTGG + Intergenic
987050590 5:14144175-14144197 CCCGGCAGCCGCGGCTTCGCGGG + Intronic
989376840 5:40772707-40772729 CACTGCAGCCTCGGCTTCCCTGG + Intronic
990041522 5:51383168-51383190 CCCGGCAGCCCGAGCTTCGGGGG + Intergenic
993470460 5:88301487-88301509 CACGGCAGCCTCCGCCTCGCAGG + Intergenic
995854122 5:116574828-116574850 CCCGGGAGCGGCGGCCTCTCCGG - Exonic
997302082 5:132813638-132813660 CCCGGCAGCCGCAGCGGCGGCGG - Exonic
999782245 5:154858732-154858754 CCCGCCAGCCAGCGCTTCGCGGG + Exonic
1001665679 5:173431872-173431894 CACTGCAGCCTCGGCTTCTCAGG - Intergenic
1001943287 5:175755881-175755903 CCCTGCAGCCTCTGCTTCCCAGG - Intergenic
1002666852 5:180831485-180831507 CCCTGCAGCCGCCGCCTCCCGGG + Intergenic
1002951862 6:1821351-1821373 CCCACCAGCCGCGGCTCCCCTGG - Intronic
1006706857 6:36028020-36028042 CGCGGCAGCCGCACCTGCGCGGG + Exonic
1007161079 6:39792353-39792375 GGCGGCAGCCGCGGCTTCCCGGG + Intronic
1007630311 6:43269754-43269776 CCCGGCGGCGGCGGCTCCTCGGG + Intronic
1008210104 6:48711689-48711711 CCCTGCAGCCTCGACTTCCCTGG - Intergenic
1010205035 6:73315012-73315034 CGCGGCGGCAGCGGCTTCGCTGG + Intergenic
1010974028 6:82292931-82292953 CACTGCAGCCTCGGCCTCGCGGG - Intergenic
1012582038 6:100881216-100881238 CCCGGCAAGCGCGGCTTGGAGGG - Exonic
1015148927 6:130018508-130018530 CCCGGCAGCGGCGGCGGCGGCGG + Exonic
1015910227 6:138162006-138162028 CCAGGCAGCGGCGGCTTCCCCGG + Exonic
1017662429 6:156687454-156687476 CCCGGCCGCGGCGGCCTCGGCGG + Intergenic
1019587339 7:1812747-1812769 CCCGGCAGCCAGGGCTGGGCAGG + Intergenic
1019724059 7:2591175-2591197 CACGGCAGCCTCGACTTCCCAGG - Intronic
1021158753 7:17245536-17245558 CCCTGCAGCCTCGGCCTCCCAGG - Intergenic
1022427950 7:30285542-30285564 CGCGGCCGCCGCGGCGCCGCCGG - Exonic
1023810325 7:43906519-43906541 GCCGGCAGCCGCGGGGGCGCAGG + Intronic
1024479476 7:49849178-49849200 CCCCACAGCCGAGGCTTCACGGG - Intronic
1026858299 7:73769203-73769225 CCCAGCAGCCACGGCTTTGCGGG - Exonic
1028521031 7:91731006-91731028 CCCGCCAGCCTCGGCCTCCCAGG + Intronic
1029461027 7:100694029-100694051 CGCGGCCGCCGCGGCGTCGGGGG + Intergenic
1029672773 7:102045402-102045424 CCCGGCAGTGGCGGCAGCGCCGG - Intronic
1032013565 7:128361648-128361670 CCCGGCGCGGGCGGCTTCGCCGG - Exonic
1032076784 7:128839861-128839883 CCCGGCAGCCCCGGTTGTGCTGG + Intronic
1032119398 7:129145230-129145252 CCCTGCAGACGCGGCGTCCCCGG - Intronic
1034969988 7:155412911-155412933 CCCGGCAGCTGTGACTTCCCAGG - Intergenic
1036406316 8:8458456-8458478 CACTGCAGCCTCGACTTCGCAGG - Intergenic
1036482478 8:9151060-9151082 CCCGGGAGCTGCGGCTGCGGCGG - Intronic
1037805175 8:22054864-22054886 CCCTGCTGCCGCGGCTGAGCCGG + Intronic
1038266752 8:26044178-26044200 CCCGGCCGCCTCGTCTTCCCGGG + Intronic
1038540375 8:28385916-28385938 CCCGACAGCCGCGGGCGCGCGGG + Intronic
1039595604 8:38787662-38787684 CCCGCCAGCCTCGTCCTCGCCGG - Exonic
1040038751 8:42896421-42896443 CCCGCCGTCCGCGGCTCCGCGGG + Exonic
1042556580 8:70038420-70038442 CCCGGCAACCTCGGCTTCCCAGG - Intergenic
1042962938 8:74321687-74321709 CCCGGGAGCCGCCGCTTCCTCGG + Intronic
1046770495 8:118112158-118112180 CCCGGCCGCCGCGTTTCCGCAGG - Intergenic
1049405438 8:142450078-142450100 CCCAGCAGCAGCGGCCCCGCCGG - Exonic
1049592369 8:143468489-143468511 TCCGGCAGGCGCGGCAGCGCAGG - Exonic
1056475119 9:86946004-86946026 CCCGGCAGCAGCGGCTCGGACGG - Exonic
1060147977 9:121268329-121268351 CCCGGCCGCGGGGGCATCGCTGG + Intronic
1060608669 9:124940989-124941011 CCCGGGAGGCGGGGCTTTGCTGG - Exonic
1060612276 9:124978363-124978385 CCCTGCAGCCTCCGCTTCCCGGG - Intronic
1061364295 9:130163388-130163410 CCCTGCAGCCTCTGCTTCCCAGG + Intergenic
1062331267 9:136045940-136045962 ACCGGGAGCCGGGGCTTCCCCGG - Intronic
1062516099 9:136937260-136937282 CCCTGCAGCCGTGGCCTCCCAGG + Intronic
1203473847 Un_GL000220v1:134136-134158 CCCTGCAGCCTCCGCTTCCCTGG - Intergenic
1186973323 X:14873229-14873251 CCCGCCAGCCGCGAGATCGCCGG - Intergenic
1195884426 X:109624670-109624692 CGCGGCAGCCTCGGCGTCGGCGG + Exonic
1197048976 X:122035561-122035583 CACTGCAGCCTCGGCTTCCCAGG + Intergenic
1197253768 X:124241516-124241538 CACTGCAGCCGCGACTTCCCAGG + Intronic
1199952004 X:152714742-152714764 CCCGGCAGCAGAGGCAGCGCTGG - Intronic
1199954643 X:152733919-152733941 CCCGGCAGCAGAGGCAGCGCTGG - Exonic
1199957679 X:152753706-152753728 CCCGGCAGCAGAGGCAGCGCTGG + Intronic
1202048219 Y:20755167-20755189 CCCGGCAGCCTCGACTTTCCGGG - Intergenic