ID: 987058245

View in Genome Browser
Species Human (GRCh38)
Location 5:14216848-14216870
Sequence TACCATATGAAGCTATTACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 169}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987058245_987058248 6 Left 987058245 5:14216848-14216870 CCTTGTAATAGCTTCATATGGTA 0: 1
1: 0
2: 1
3: 10
4: 169
Right 987058248 5:14216877-14216899 CAGACCAAGGTCTCATCGTTAGG 0: 1
1: 0
2: 0
3: 3
4: 66
987058245_987058252 12 Left 987058245 5:14216848-14216870 CCTTGTAATAGCTTCATATGGTA 0: 1
1: 0
2: 1
3: 10
4: 169
Right 987058252 5:14216883-14216905 AAGGTCTCATCGTTAGGAAGGGG 0: 1
1: 0
2: 3
3: 42
4: 402
987058245_987058253 24 Left 987058245 5:14216848-14216870 CCTTGTAATAGCTTCATATGGTA 0: 1
1: 0
2: 1
3: 10
4: 169
Right 987058253 5:14216895-14216917 TTAGGAAGGGGAGCTGACATTGG 0: 1
1: 0
2: 0
3: 31
4: 257
987058245_987058251 11 Left 987058245 5:14216848-14216870 CCTTGTAATAGCTTCATATGGTA 0: 1
1: 0
2: 1
3: 10
4: 169
Right 987058251 5:14216882-14216904 CAAGGTCTCATCGTTAGGAAGGG 0: 1
1: 0
2: 2
3: 15
4: 168
987058245_987058246 -7 Left 987058245 5:14216848-14216870 CCTTGTAATAGCTTCATATGGTA 0: 1
1: 0
2: 1
3: 10
4: 169
Right 987058246 5:14216864-14216886 TATGGTAGATAGCCAGACCAAGG 0: 1
1: 0
2: 0
3: 8
4: 71
987058245_987058250 10 Left 987058245 5:14216848-14216870 CCTTGTAATAGCTTCATATGGTA 0: 1
1: 0
2: 1
3: 10
4: 169
Right 987058250 5:14216881-14216903 CCAAGGTCTCATCGTTAGGAAGG 0: 1
1: 0
2: 1
3: 18
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987058245 Original CRISPR TACCATATGAAGCTATTACA AGG (reversed) Intronic
906081449 1:43091670-43091692 TTCCATTTGCAGCTAATACATGG - Intergenic
906560273 1:46751480-46751502 AATCATGTGATGCTATTACAAGG - Intergenic
911295274 1:96107226-96107248 TACCTTATGAATCTATTAAAGGG + Intergenic
911670769 1:100604884-100604906 TACCACATGAAATAATTACATGG + Intergenic
911711595 1:101079608-101079630 TACCATAGCAATCTATTAGAGGG + Intergenic
915256182 1:154631323-154631345 TACCATATTAACATATTAAAGGG - Intergenic
915648814 1:157292977-157292999 TTCCATATGGAGCTGCTACAAGG - Intergenic
915661894 1:157411598-157411620 TTCCATATGGAGCTGCTACAAGG + Intergenic
915771071 1:158424791-158424813 TTCCAGATAAAGCTATTTCAAGG + Intergenic
916286765 1:163114880-163114902 TACCACATTAAGCAATTAAAGGG + Intronic
916945576 1:169723298-169723320 TACCAGATGACTCTTTTACATGG + Exonic
918805708 1:189040153-189040175 AACAAAATGAAGCTATTTCAGGG - Intergenic
919590224 1:199493278-199493300 AACCAGATAAAGATATTACAAGG + Intergenic
922594800 1:226805339-226805361 TCCCATATGAAGCTATGAGAAGG - Intergenic
923207429 1:231772571-231772593 TACCTTATAGAGCTATCACATGG + Intronic
923485491 1:234425964-234425986 TAACAAATGAATATATTACAAGG + Intronic
924660371 1:246010737-246010759 TTCCATATGTAGCTGTTAGAAGG + Intronic
1062952959 10:1518589-1518611 TACCATGTGCAGATGTTACACGG - Intronic
1062952978 10:1518876-1518898 TACCACATGCAGATGTTACATGG - Intronic
1062953006 10:1519286-1519308 TACCACATGCAGATGTTACATGG - Intronic
1064812714 10:19219317-19219339 TACCATATTAAATTATTAAATGG + Intronic
1065275270 10:24079338-24079360 GGCCATTTGAAGCTATTATAGGG + Intronic
1066591376 10:36998461-36998483 CAGCATATGTTGCTATTACAAGG - Intergenic
1068017720 10:51538688-51538710 TACCATAGAAAACTATTAAAGGG - Intronic
1077812304 11:5650447-5650469 TACGATATGAAGGTATCACCTGG - Intergenic
1083205810 11:61148339-61148361 TACCAGAAGAAGCTGTTACCAGG + Intronic
1084484969 11:69442981-69443003 TGGCATATGAAGCTAGGACAAGG + Intergenic
1085707945 11:78803387-78803409 TACCCTTTGAAGCTATAAAATGG - Intronic
1088169158 11:106976125-106976147 TACCTTCTTAACCTATTACAGGG - Intronic
1089938493 11:122390466-122390488 TACCATAAGAATTTATTACTTGG + Intergenic
1093128938 12:15366172-15366194 TACCATATGGAAATATCACAAGG - Intronic
1099441058 12:82700376-82700398 TAACATCTGAAACTATTATAGGG + Intronic
1100601115 12:96112206-96112228 TTCCATATGAAGCTCTAACTTGG + Intergenic
1101590741 12:106122993-106123015 TATCAGATGAATCCATTACATGG + Intronic
1104267635 12:127250948-127250970 TGCCATTTGGAGCTATTTCAGGG - Intergenic
1107017930 13:35722705-35722727 TACCATTTGAAGCCTTTAGAAGG - Intergenic
1108512144 13:51166029-51166051 TATCAAATGAATCAATTACATGG - Intergenic
1109350231 13:61170647-61170669 AAGCATATGAAGGTATTACAGGG + Intergenic
1110545675 13:76752536-76752558 TAGGATAGGAAGCTATTACACGG - Intergenic
1110592695 13:77283222-77283244 TAACATCTGAATCAATTACATGG + Intronic
1111346911 13:86969261-86969283 TTCAACATGAGGCTATTACAAGG + Intergenic
1111796362 13:92925422-92925444 TGCCATAAGAAGCTATGAAAAGG + Intergenic
1112039680 13:95534297-95534319 AACCATATGAAGCTACTGCCAGG + Intronic
1115301618 14:31892030-31892052 TACCACACAAAGTTATTACAAGG - Intergenic
1117011337 14:51473573-51473595 TTTCATATGAAGGTATTACCTGG + Intergenic
1117167017 14:53045629-53045651 TACCTCAAGAAGCTAGTACATGG + Exonic
1118223941 14:63881303-63881325 TTACCTATGAAGCTATTACCAGG + Intronic
1118295056 14:64560941-64560963 GACCATATGAAGCTCTGAGAGGG + Intronic
1118773047 14:68955134-68955156 TACCCTATGAAGCTCCCACAGGG + Intronic
1121160719 14:91737245-91737267 TATCATACAAAGCTATTAGAGGG + Intronic
1124214976 15:27798879-27798901 TTTCAAATCAAGCTATTACATGG - Intronic
1127084338 15:55411078-55411100 AACCATATTATGCTAATACAAGG + Intronic
1127650572 15:61002526-61002548 TACCATATAAAAATATTAAAGGG + Intronic
1129587348 15:76881997-76882019 TAGCATATGCAGCATTTACATGG - Intronic
1129954782 15:79625985-79626007 TGCCTTATGAAGCAATTTCATGG + Intergenic
1132162948 15:99560204-99560226 CACCATATGAAGCAATGAGACGG - Intergenic
1133737566 16:8627495-8627517 CACCATAACAAGCTAATACAGGG - Intronic
1137008869 16:35303776-35303798 GATCATATGAAGCTCTTACATGG - Intergenic
1137027799 16:35495948-35495970 GACCATATGAAGCCATTAAGTGG - Intergenic
1137997244 16:53231681-53231703 TGCCATATGAAGATAGTACTTGG + Exonic
1138164389 16:54786848-54786870 TTCCATATGAAGTTACTATAAGG + Intergenic
1144417194 17:15060757-15060779 AACCAGATGAAGATAATACAAGG + Intergenic
1146003090 17:29143155-29143177 TACCACATGGGGTTATTACATGG + Intronic
1146039757 17:29440460-29440482 TACCATATGAGCTTATTAAAAGG + Intronic
1147542521 17:41372614-41372636 TAGCATCTGCCGCTATTACATGG - Intronic
1156621819 18:38861307-38861329 AACCATATAAAACTATTATAGGG + Intergenic
1157756885 18:50226516-50226538 CACTAAAGGAAGCTATTACAGGG - Intergenic
1158226072 18:55202952-55202974 TACCATATGAGGCTAATATTAGG + Intergenic
1159438933 18:68453097-68453119 AACCATAGGAAGTTAATACAAGG + Intergenic
1161842372 19:6690426-6690448 TAACATGTGAAACTATTAGAGGG + Intronic
926365537 2:12129801-12129823 AACCATATGAAGAGATCACAGGG - Intergenic
926509399 2:13755379-13755401 TGCCATGTGAAGATATAACAAGG - Intergenic
931972738 2:67607515-67607537 TACCATATGCACTTATCACAGGG - Intergenic
932394693 2:71434076-71434098 TGCAATATGAAGCTACTAGAAGG - Intronic
932918446 2:75882274-75882296 CACCATATGTAGTTATTACAGGG - Intergenic
934935880 2:98465090-98465112 AACCACAGGAAGCTAATACAAGG - Intronic
936764150 2:115824932-115824954 TACCTTCTAAACCTATTACATGG + Intronic
941135726 2:161715854-161715876 TACCATTTGACCCTATTACTGGG - Intronic
943802648 2:192081667-192081689 TACCATATGGGCATATTACATGG + Intronic
944406453 2:199390271-199390293 TGCCATTTAAAACTATTACATGG + Intronic
944466714 2:200008679-200008701 AACCATAAGAAACTACTACAAGG + Intergenic
945650487 2:212552484-212552506 TAACATACAAAGCTATTACTTGG - Intergenic
949066034 2:241990817-241990839 CAGCATCTGAAGCTAATACAGGG - Intergenic
1172595007 20:36144855-36144877 AACCATATGGAGTTATTATAAGG - Intronic
1175243520 20:57567295-57567317 TTCCATATGAAGCCATTGTAAGG - Exonic
1177250124 21:18581966-18581988 TACCATATGACACTTTTCCAGGG + Intergenic
1178376515 21:32072035-32072057 TACAAGATGAAGTCATTACAAGG - Intergenic
1178682832 21:34687420-34687442 TACCAACTGAAGCTTTTACATGG - Intronic
950101865 3:10362170-10362192 TACCAGATGAACCTCTCACAAGG + Intronic
951686900 3:25354527-25354549 TACCATGGGAAGGTATTCCATGG - Intronic
952043192 3:29284883-29284905 TACCAAAAGAAGCAATTTCAAGG + Intronic
953268051 3:41412430-41412452 TTCCATATGAAACTTTGACATGG - Intronic
954720578 3:52558791-52558813 TTCAATATGAAGCAATTCCATGG + Intronic
957905303 3:86545716-86545738 TTCCACATGAAGTTATTATAAGG - Intergenic
959489143 3:106966648-106966670 TACCACATGAATATATTAAAAGG - Intergenic
959793275 3:110390906-110390928 TTCCTTATGAAGCTCATACAAGG + Intergenic
962449552 3:135501306-135501328 TACCTTATAATGCCATTACAAGG - Intergenic
963006773 3:140733799-140733821 AGCCATAGGAAGCTAATACATGG - Intergenic
963544580 3:146640293-146640315 TATAACATGAAGATATTACATGG + Intergenic
964440894 3:156707994-156708016 CAACATACGATGCTATTACAGGG - Intergenic
966427148 3:179791857-179791879 TGCAATAGGAAGCTATTATAGGG + Intergenic
967802565 3:193679340-193679362 TACCAAATGATGCAGTTACATGG - Intronic
968335202 3:197907731-197907753 TCCCAGATGAAGTTATCACAGGG + Intronic
968335214 3:197907797-197907819 TCCCAGATGAAGTTATCACAGGG + Intronic
968335227 3:197907863-197907885 TCCCAGATGAAGTTATCACAGGG + Intronic
968335240 3:197907930-197907952 TCCCAGATGAAGTTATCACAGGG + Intronic
968335253 3:197907996-197908018 TCCCAGATGAAGTTATCACAGGG + Intronic
968335266 3:197908069-197908091 TCCCAGATGAAGTTATCACAGGG + Intronic
968335278 3:197908136-197908158 TCCCAGATGAAGTTATCACAGGG + Intronic
968335291 3:197908203-197908225 TCCCAGATGAAGTTATCACAGGG + Intronic
968335305 3:197908270-197908292 TCCCAGATGAAGTTATCACAGGG + Intronic
968335317 3:197908336-197908358 TCCCAGATGAAGTTATCACAGGG + Intronic
968335330 3:197908403-197908425 TCCCAGATGAAGTTATCACAGGG + Intronic
968335343 3:197908469-197908491 TCCCAGATGAAGTTATCACAGGG + Intronic
968335356 3:197908536-197908558 TCCCAGATGAAGTTATCACAGGG + Intronic
968335369 3:197908606-197908628 TCCCAGATGAAGTTATCACAGGG + Intronic
968335383 3:197908675-197908697 TCCCAGATGAAGTTATCACAGGG + Intronic
968335412 3:197908818-197908840 TCCCAGATGAAGTTATCACAGGG + Intronic
968335425 3:197908888-197908910 TCCCAGATGAAGTTATCACAGGG + Intronic
971077996 4:23172659-23172681 TACCAAATTATGTTATTACAAGG + Intergenic
973144387 4:46806044-46806066 TTTCATATGAGGCAATTACAAGG - Intronic
976468080 4:85394461-85394483 TACCATGTGAAGGTATAGCAAGG - Intergenic
982286058 4:153736427-153736449 TACCATATGAAGACATTACAAGG - Intronic
983180881 4:164647080-164647102 TACTATATGGAGCTTTTAAATGG + Intergenic
983325670 4:166252816-166252838 TACCATATGGGGATATTTCACGG - Intergenic
984072109 4:175128168-175128190 CCCCATATGAGGATATTACATGG + Intergenic
984886506 4:184454681-184454703 TACCATATTATGCTTTAACAAGG - Intronic
987058245 5:14216848-14216870 TACCATATGAAGCTATTACAAGG - Intronic
987505607 5:18766938-18766960 TACTATATGGAGCTATAACCTGG + Intergenic
987772851 5:22329577-22329599 TAATATATGAAGCTAAAACAAGG - Intronic
988638105 5:33009529-33009551 TTCGATGTGTAGCTATTACATGG - Intergenic
989018685 5:36973249-36973271 TACCATATGAAGCAGATACGAGG - Intronic
989803595 5:45576412-45576434 TAGCTTATGATGCTATTTCATGG - Intronic
992317796 5:75576544-75576566 TATCAAATGAAGCTATTTTATGG + Intronic
994401543 5:99286849-99286871 TAACAAATGAAAATATTACATGG - Intergenic
995380328 5:111524591-111524613 TACCAATTGATGCTATTAAAAGG + Intergenic
996238805 5:121169473-121169495 TACCTTCTGAAACTATAACATGG - Intergenic
996290253 5:121844275-121844297 AACCATAGGAAACTAATACAAGG - Intergenic
996513665 5:124345846-124345868 TCCCACATGAAGCTATTTAAAGG - Intergenic
998229737 5:140353167-140353189 TACCAGAGGAATTTATTACATGG - Intergenic
999536128 5:152519262-152519284 TACAATTTGAAGCTAGTAAAGGG + Intergenic
1004195233 6:13498304-13498326 TAAAATATGAAGATATTAAAGGG + Intergenic
1007530977 6:42542159-42542181 TTCCTTATGAAGCTATTGAAGGG + Intergenic
1008830912 6:55760751-55760773 TACCTGATGAAGCTCTAACATGG + Intronic
1010299034 6:74237311-74237333 TACCCTATTATGCTATTAAATGG + Intergenic
1013057600 6:106599179-106599201 TCCCATACAAAGCTATTATAAGG - Intronic
1015093714 6:129389435-129389457 TACCACATGAAACTATAACAAGG - Intronic
1015169550 6:130236886-130236908 AACCATATGAAGTTGATACAAGG - Intronic
1017486541 6:154907327-154907349 GACCATATGATCCTATTAAAAGG + Intronic
1022740537 7:33116119-33116141 TACCATTTGACGCCATAACATGG - Intergenic
1027550465 7:79586764-79586786 AACTATATGCAGGTATTACATGG - Intergenic
1027557860 7:79688000-79688022 TTCAATATGAAGCTTTTATAAGG - Intergenic
1030364935 7:108635054-108635076 TGTAATATGTAGCTATTACATGG - Intergenic
1031151916 7:118063608-118063630 TATCACAAGTAGCTATTACATGG - Intergenic
1031315351 7:120250973-120250995 AACCAGATAAAGCTATTACAAGG + Intergenic
1033246552 7:139721273-139721295 TTCCTTATGAAGGTATTTCAGGG - Intronic
1033961770 7:146922209-146922231 TAACATGTGAAGGAATTACAGGG - Intronic
1034710671 7:153188871-153188893 TGCAATAGGAAGCTATTAAAGGG - Intergenic
1037009630 8:13824402-13824424 TACCACAAAAAGCTATTAAATGG - Intergenic
1038884211 8:31645909-31645931 TCCCCTATGAAGATACTACAGGG + Intronic
1039200999 8:35094207-35094229 TAGAATAGGAAGCCATTACAGGG + Intergenic
1041608302 8:59812352-59812374 TACCACATGATGTTATTATAAGG - Intergenic
1042055018 8:64755253-64755275 AATCATATGAAGCACTTACATGG - Intronic
1042455990 8:69003496-69003518 TACAATTGGAAGCTATTACATGG - Intergenic
1044129533 8:88504622-88504644 TCCCAAGTGATGCTATTACATGG - Intergenic
1050267234 9:3904012-3904034 TACAATAGGAAACTCTTACAGGG + Intronic
1053227579 9:36374155-36374177 TACCTTATTAACCAATTACATGG - Intronic
1053564677 9:39236682-39236704 TAGGAAATGAAGCTATTAAATGG + Intronic
1053830459 9:42074583-42074605 TAGGAAATGAAGCTATTAAATGG + Intronic
1054132475 9:61382352-61382374 TAGGAAATGAAGCTATTAAATGG - Intergenic
1054600100 9:67112872-67112894 TAGGAAATGAAGCTATTAAATGG - Intergenic
1054717670 9:68572649-68572671 TACCTTATGAAGCTAACACTTGG - Intergenic
1059918092 9:119126229-119126251 TGCCATATGAAGCAAGCACAAGG - Intergenic
1060060202 9:120453082-120453104 AACCTTATGTAGCCATTACAAGG + Intronic
1060147575 9:121266090-121266112 CACCAAATGGAGCAATTACAGGG + Intronic
1188629735 X:32339606-32339628 TACCATATATAGCTCTGACATGG + Intronic
1193803716 X:85969449-85969471 TAAACTATGAAACTATTACATGG + Intronic
1194886790 X:99325411-99325433 GACCATGTGATGCTTTTACAGGG - Intergenic
1198675141 X:139123264-139123286 TACAATAAGAAGCTTTTAGAAGG - Intronic
1201402355 Y:13617127-13617149 TACCATTGGAAAGTATTACAAGG - Intergenic
1201412459 Y:13713847-13713869 GAACATATGAAGCAATTGCAAGG + Intergenic