ID: 987061727

View in Genome Browser
Species Human (GRCh38)
Location 5:14249802-14249824
Sequence CCATCAAATGAAGCTGCTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 125}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987061727_987061733 25 Left 987061727 5:14249802-14249824 CCCAGAGCAGCTTCATTTGATGG 0: 1
1: 0
2: 2
3: 13
4: 125
Right 987061733 5:14249850-14249872 TAAATCACCCACCCTCAGAATGG No data
987061727_987061732 -8 Left 987061727 5:14249802-14249824 CCCAGAGCAGCTTCATTTGATGG 0: 1
1: 0
2: 2
3: 13
4: 125
Right 987061732 5:14249817-14249839 TTTGATGGTGGGAGAGAACATGG 0: 1
1: 1
2: 3
3: 37
4: 484

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987061727 Original CRISPR CCATCAAATGAAGCTGCTCT GGG (reversed) Intronic