ID: 987061732

View in Genome Browser
Species Human (GRCh38)
Location 5:14249817-14249839
Sequence TTTGATGGTGGGAGAGAACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 526
Summary {0: 1, 1: 1, 2: 3, 3: 37, 4: 484}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987061724_987061732 16 Left 987061724 5:14249778-14249800 CCTGCATCCTCAAGCTGCCTGAC 0: 1
1: 0
2: 2
3: 25
4: 221
Right 987061732 5:14249817-14249839 TTTGATGGTGGGAGAGAACATGG 0: 1
1: 1
2: 3
3: 37
4: 484
987061727_987061732 -8 Left 987061727 5:14249802-14249824 CCCAGAGCAGCTTCATTTGATGG 0: 1
1: 0
2: 2
3: 13
4: 125
Right 987061732 5:14249817-14249839 TTTGATGGTGGGAGAGAACATGG 0: 1
1: 1
2: 3
3: 37
4: 484
987061726_987061732 -1 Left 987061726 5:14249795-14249817 CCTGACACCCAGAGCAGCTTCAT 0: 1
1: 0
2: 3
3: 20
4: 209
Right 987061732 5:14249817-14249839 TTTGATGGTGGGAGAGAACATGG 0: 1
1: 1
2: 3
3: 37
4: 484
987061729_987061732 -9 Left 987061729 5:14249803-14249825 CCAGAGCAGCTTCATTTGATGGT No data
Right 987061732 5:14249817-14249839 TTTGATGGTGGGAGAGAACATGG 0: 1
1: 1
2: 3
3: 37
4: 484
987061725_987061732 9 Left 987061725 5:14249785-14249807 CCTCAAGCTGCCTGACACCCAGA 0: 1
1: 1
2: 2
3: 35
4: 291
Right 987061732 5:14249817-14249839 TTTGATGGTGGGAGAGAACATGG 0: 1
1: 1
2: 3
3: 37
4: 484

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987061732 Original CRISPR TTTGATGGTGGGAGAGAACA TGG Intronic