ID: 987061733

View in Genome Browser
Species Human (GRCh38)
Location 5:14249850-14249872
Sequence TAAATCACCCACCCTCAGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987061727_987061733 25 Left 987061727 5:14249802-14249824 CCCAGAGCAGCTTCATTTGATGG 0: 1
1: 0
2: 2
3: 13
4: 125
Right 987061733 5:14249850-14249872 TAAATCACCCACCCTCAGAATGG No data
987061729_987061733 24 Left 987061729 5:14249803-14249825 CCAGAGCAGCTTCATTTGATGGT No data
Right 987061733 5:14249850-14249872 TAAATCACCCACCCTCAGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987061733 Original CRISPR TAAATCACCCACCCTCAGAA TGG Intronic