ID: 987062152

View in Genome Browser
Species Human (GRCh38)
Location 5:14252927-14252949
Sequence GCATGGCGGTACTGCAGTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 129}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987062152_987062158 13 Left 987062152 5:14252927-14252949 CCTGGACTGCAGTACCGCCATGC 0: 1
1: 0
2: 0
3: 7
4: 129
Right 987062158 5:14252963-14252985 TTCGCCTCACTGGGGCAGCCTGG 0: 1
1: 0
2: 2
3: 7
4: 123
987062152_987062157 5 Left 987062152 5:14252927-14252949 CCTGGACTGCAGTACCGCCATGC 0: 1
1: 0
2: 0
3: 7
4: 129
Right 987062157 5:14252955-14252977 GCTATCATTTCGCCTCACTGGGG 0: 1
1: 0
2: 0
3: 10
4: 51
987062152_987062156 4 Left 987062152 5:14252927-14252949 CCTGGACTGCAGTACCGCCATGC 0: 1
1: 0
2: 0
3: 7
4: 129
Right 987062156 5:14252954-14252976 TGCTATCATTTCGCCTCACTGGG 0: 1
1: 0
2: 0
3: 9
4: 82
987062152_987062155 3 Left 987062152 5:14252927-14252949 CCTGGACTGCAGTACCGCCATGC 0: 1
1: 0
2: 0
3: 7
4: 129
Right 987062155 5:14252953-14252975 CTGCTATCATTTCGCCTCACTGG 0: 1
1: 0
2: 0
3: 10
4: 72

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987062152 Original CRISPR GCATGGCGGTACTGCAGTCC AGG (reversed) Intronic
900034619 1:396669-396691 GCATGGCTGTACTCCAGCCTAGG - Intergenic
900055450 1:626557-626579 GCATGGCTGTACTCCAGCCTAGG - Intergenic
903656023 1:24949344-24949366 GCATGGCTGGAGTGCAGCCCTGG - Intronic
904075646 1:27840015-27840037 GCATGACTGTACTCCAGTCTGGG + Intronic
904941659 1:34167749-34167771 GCATGCCGGTTCTTCAGTCATGG - Intronic
908499521 1:64729333-64729355 GCCTGGCTGCACTGCAGTCTAGG - Intergenic
912672935 1:111648372-111648394 GCATGGAGTTGCTGCTGTCCAGG + Intronic
914846702 1:151287509-151287531 GCATGGCAGTACTGGCGTTCTGG - Exonic
915409704 1:155690788-155690810 GGAAGGCAGTAGTGCAGTCCTGG + Intronic
922245336 1:223790645-223790667 GCATTGCTGTACTCCAGTCTGGG - Intronic
922428416 1:225521836-225521858 GCATGGCTGTACTCCAGCCTGGG - Intronic
923915069 1:238492539-238492561 GCATGGAGTTGCTGCTGTCCGGG - Intergenic
1065576153 10:27120796-27120818 GCATGCAGGTAATTCAGTCCAGG + Intronic
1070327022 10:75396103-75396125 GCGTGGCGGTGCTGCAGCCGGGG - Intergenic
1071736110 10:88303034-88303056 GCATGGGGCTACTGCACACCTGG + Intronic
1075634159 10:124019048-124019070 GCATGGAGGACCTTCAGTCCTGG - Intronic
1076314527 10:129531230-129531252 GCATGGCGGTATTACTGTGCGGG + Intronic
1076477482 10:130762625-130762647 CCATGGAGTTACTGCAGCCCGGG + Intergenic
1077201546 11:1309852-1309874 GCGTGGCGGCGCTGCAGTCTGGG + Intergenic
1077515027 11:2996235-2996257 GCCTGGCCCTACTGCAGTCCAGG + Intergenic
1081031500 11:38089961-38089983 GCCTGAGGGTACTGCAGACCAGG - Intergenic
1083155812 11:60822171-60822193 GCAGGGAGGATCTGCAGTCCTGG - Intergenic
1086255533 11:84871768-84871790 GGATCGTGGTACTGCACTCCAGG - Intronic
1094169993 12:27481076-27481098 GCATGGTGATACTGCAGCTCTGG + Intronic
1094818149 12:34205944-34205966 GCCTGGCGGTGCTGCAGTGGCGG - Intergenic
1101468887 12:104976834-104976856 GCATGGAGTTGCTGCTGTCCAGG + Intergenic
1102501965 12:113359019-113359041 GCAGGGCGGTGCTGCAGCCTCGG - Intronic
1104867006 12:131961587-131961609 GCCTGGGGGCACGGCAGTCCTGG - Exonic
1104885555 12:132104955-132104977 GCCTGGGGGCACGGCAGTCCTGG - Exonic
1105491615 13:20893721-20893743 GCATTGCGCCACTGCACTCCTGG + Intronic
1112368603 13:98775577-98775599 CCGTGGCTGTACTGCTGTCCTGG + Intergenic
1113407830 13:110057663-110057685 GCCTGGCTGTACTGCCCTCCTGG + Intergenic
1113859960 13:113475544-113475566 GCATGGCTGTACTGCAGATGAGG + Intronic
1115662604 14:35511908-35511930 GCATGGAGTTGCTGCTGTCCAGG + Intergenic
1118966942 14:70595721-70595743 GCATGGAGTTGCTGCTGTCCAGG - Intronic
1119483924 14:74976156-74976178 GCATGGTGGTAGTGCATTCCAGG - Intergenic
1122601530 14:102924074-102924096 GCATGGAGGCACTGCAGGACTGG + Intronic
1127063457 15:55212575-55212597 GGATGGCGCCACTGCACTCCAGG - Intronic
1131447928 15:92514856-92514878 GCTTGGCGGCAGTACAGTCCAGG - Intergenic
1136010538 16:27360698-27360720 GCATTGCCGTACTCCAGGCCGGG + Intronic
1138123507 16:54420093-54420115 GGATGGTGGAACTCCAGTCCAGG - Intergenic
1138439050 16:57023538-57023560 GCCTGGCAGTCTTGCAGTCCAGG - Intronic
1140182060 16:72729797-72729819 GCATGGAGTTGCTGCTGTCCAGG - Intergenic
1142661336 17:1431633-1431655 TGATTGCGCTACTGCAGTCCAGG - Intronic
1142704292 17:1684663-1684685 GTGTGGCGGGACTGCAGGCCGGG - Exonic
1145841413 17:27998289-27998311 GCAAGGCAGAACTGCACTCCGGG - Intergenic
1145871332 17:28276130-28276152 GCATGGAGTTGCTGCTGTCCAGG + Intergenic
1146925161 17:36739540-36739562 GCATGCCGCCACTGCACTCCAGG - Intergenic
1147953566 17:44120292-44120314 GCATGGTGGTACTGGACTCCAGG - Intronic
1150679880 17:67276201-67276223 GCATGGAGTTGCTGCTGTCCAGG + Intergenic
1153992544 18:10413160-10413182 GCTTGGCGGTATCGCATTCCTGG + Intergenic
1160447186 18:78936822-78936844 GCAGGGCGGTAGCACAGTCCAGG + Intergenic
1163987254 19:20965092-20965114 GCATGGAGTTGCTGCTGTCCAGG - Intergenic
925823372 2:7822596-7822618 GCCTGGCTGGACAGCAGTCCTGG - Intergenic
925863408 2:8202208-8202230 GCATGGAGGTACTTCATTCTTGG + Intergenic
926133196 2:10318415-10318437 GCAAGGGTCTACTGCAGTCCCGG + Intronic
928495002 2:31822690-31822712 GCATGGAGTTGCTGCAGTCCAGG + Intergenic
932056492 2:68448617-68448639 GCATGGCGGCCCTGCTGACCTGG + Intergenic
932743057 2:74306811-74306833 GCATGGAGTTGCTGCTGTCCAGG + Intronic
935790610 2:106586747-106586769 GCATGATGATACTGTAGTCCTGG - Intergenic
942294147 2:174501214-174501236 GCATTGAGCTACTGCAGTCTTGG + Intergenic
943548575 2:189311346-189311368 GCATGGAGTTGCTGCTGTCCAGG + Intergenic
946737442 2:222768111-222768133 AGATGGCGCTACTGCACTCCAGG + Intergenic
948909772 2:240997223-240997245 CCATGGCTGTGCTGCTGTCCTGG + Intergenic
1171823224 20:29874303-29874325 GCCTGGCGGTGCTGCAGTGGCGG - Intergenic
1173209928 20:41024358-41024380 TCCTGGAGGTACTGCAATCCAGG - Intergenic
1176336267 21:5602603-5602625 GCATGTTGGGATTGCAGTCCTGG - Intergenic
1176391490 21:6218345-6218367 GCATGTTGGGATTGCAGTCCTGG + Intergenic
1176469929 21:7097829-7097851 GCATGTTGGGATTGCAGTCCTGG - Intergenic
1176493490 21:7479607-7479629 GCATGTTGGGATTGCAGTCCTGG - Intergenic
1176507152 21:7658776-7658798 GCATGTTGGGATTGCAGTCCTGG + Intergenic
1176868739 21:14071113-14071135 GCCTGGCGGTACTGCAGCGGTGG - Intergenic
1181092391 22:20482901-20482923 GCATGGAGTTGCTGCTGTCCAGG + Intronic
1182280976 22:29217495-29217517 GCTTGGGGGTGCTGCACTCCAGG + Intronic
1184448435 22:44568142-44568164 GCATGGAGTTGCTGCTGTCCAGG - Intergenic
950079794 3:10213203-10213225 GAATGGAGGTGCTGAAGTCCTGG - Exonic
950403244 3:12787475-12787497 GCATGGAGTTGCTGCTGTCCAGG + Intergenic
952319234 3:32260122-32260144 GCATGGAGTTGCTGCTGTCCAGG - Intronic
955720568 3:61876152-61876174 GCATAACTGTACTCCAGTCCTGG + Intronic
963076054 3:141347143-141347165 GCATGGCATTTCTGCAGTCATGG + Intronic
964483276 3:157162749-157162771 GCATGGAGTTGCTGCTGTCCAGG + Intergenic
966183020 3:177204049-177204071 GCATGGCGGGCCGGCAGTGCTGG + Intergenic
973981660 4:56313295-56313317 GCTTGGCGGCACTGTTGTCCAGG - Exonic
979050341 4:115921870-115921892 GCATGGAGTTGCTGCTGTCCAGG - Intergenic
979099497 4:116598196-116598218 GCATGGCAGTCTTGTAGTCCTGG - Intergenic
979536196 4:121823461-121823483 CGCTGGCGGTACTGAAGTCCGGG - Exonic
981094074 4:140760683-140760705 AGATGGCGGCACTGCACTCCAGG - Intergenic
983554636 4:169049181-169049203 GCATAATGGTGCTGCAGTCCTGG - Intergenic
984623665 4:181981028-181981050 GCATGGGGGTGTTGGAGTCCTGG - Intergenic
985444667 4:190015375-190015397 GCCTGGCGGTGCTGCAGTGGCGG - Intergenic
986616558 5:9623406-9623428 TCTTGGAGGTGCTGCAGTCCTGG + Intergenic
986802150 5:11272674-11272696 GCATAGTTGTACTGCAGTTCAGG - Intronic
987062152 5:14252927-14252949 GCATGGCGGTACTGCAGTCCAGG - Intronic
987914898 5:24200276-24200298 GCATGGGGCTACTGCACACCAGG + Intergenic
989012298 5:36886389-36886411 GCATGGAGTTGCTGCTGTCCAGG - Intronic
993178566 5:84519234-84519256 GCATGGGGCTACTGCATACCAGG - Intergenic
1002739200 5:181422201-181422223 GCATGGCTGTACTCCAGCCTAGG + Intergenic
1004250332 6:14018241-14018263 GCATGGGGGTGCTGCAGGTCCGG - Intergenic
1004843550 6:19613927-19613949 GCATGGGGTTGCTGCTGTCCAGG - Intergenic
1005761125 6:28969217-28969239 GCATGGAGTTGCTGCTGTCCAGG + Intergenic
1006883062 6:37356038-37356060 GCTTGTCAGTACTGCAGTCTTGG + Intronic
1007117472 6:39353745-39353767 GGATGGCGGTGCTGTAGCCCTGG + Intronic
1011242694 6:85288901-85288923 GCATGGAGTTACTGCTGTCCAGG - Intergenic
1013667247 6:112361523-112361545 GCATGGAGGTGCTGCTGTCCAGG + Intergenic
1013992217 6:116266075-116266097 GCATGGGGCTACTGCACACCAGG - Intronic
1019244310 6:170697761-170697783 GCATGGCTGTACTCCAGCCTAGG + Intergenic
1019452128 7:1104496-1104518 GCATGTCAGTACTGCAGCTCCGG + Intronic
1022601245 7:31762386-31762408 GGATGGCGCCACTGCACTCCAGG - Intronic
1023603863 7:41909386-41909408 GCCTGACGGCACTGCAGACCAGG + Intergenic
1024321524 7:48075890-48075912 GCACGGCTGTACTCCAGTCTGGG + Intergenic
1026382320 7:69811979-69812001 GCAAGGCTGTAATGCAGACCAGG + Intronic
1032415176 7:131730085-131730107 GCAGGGAGGTGCTGCAGTCATGG + Intergenic
1035503815 8:110410-110432 GCATGGCTGTACTCCAGCCTAGG - Intergenic
1037484687 8:19336210-19336232 GCCTGGGGGTCCTGCAGACCTGG - Intronic
1037584500 8:20267341-20267363 GGAGGGCGGTGCTGCAGTCAGGG + Intronic
1037825200 8:22156522-22156544 GCATGGCGGGGCTGCGGGCCAGG - Exonic
1038792580 8:30681381-30681403 GCATGGTGGTGGTGCAGGCCTGG + Intronic
1039866854 8:41512417-41512439 GCATGGAGTTGCTGCTGTCCAGG - Intergenic
1044082655 8:87904297-87904319 GCATGGCTACACTGCAGTTCAGG + Intergenic
1051789733 9:20787435-20787457 GCATGGCTATCCTGAAGTCCTGG + Intronic
1052612905 9:30799548-30799570 GCATGGAGTTGCTGCTGTCCAGG + Intergenic
1053530702 9:38878589-38878611 GCATGGGGCTACTGCACACCAGG + Intergenic
1054202925 9:62103022-62103044 GCATGGGGCTACTGCACACCAGG + Intergenic
1054254944 9:62802173-62802195 GCCTGGCGGTGCTGCAGTGGCGG + Intergenic
1054336364 9:63813432-63813454 GCCTGGCGGTGCTGCAGTGGCGG - Intergenic
1054635438 9:67485343-67485365 GCATGGGGCTACTGCACACCAGG - Intergenic
1055267649 9:74516071-74516093 GCATGGAAGTAAAGCAGTCCAGG + Intronic
1055708764 9:79036494-79036516 GCATGGAGTTGCTGCTGTCCAGG + Intergenic
1057739695 9:97700628-97700650 GCATGGAGTTGCTGCTGTCCAGG - Intergenic
1061072848 9:128322435-128322457 GCCTGGCGGTACTTCCGTCCAGG - Exonic
1061213415 9:129206453-129206475 CCATGGCGGATCTGCAGGCCAGG - Intergenic
1203425376 Un_GL000195v1:32299-32321 GCATGTTGGGATTGCAGTCCTGG + Intergenic
1203376292 Un_KI270442v1:380836-380858 GCCTGGCGGTGCTGCAGTGGCGG - Intergenic
1203604498 Un_KI270748v1:46985-47007 GCATGGCTGTACTCCAGCCTAGG + Intergenic
1187797839 X:23023674-23023696 GCATGGGCCTACTTCAGTCCTGG + Intergenic
1190890360 X:54561991-54562013 GCATAGCATTACTGCAGTCTTGG + Intergenic
1201106121 Y:10764684-10764706 AGATGGCGCTACTGCACTCCAGG - Intergenic