ID: 987066296

View in Genome Browser
Species Human (GRCh38)
Location 5:14293141-14293163
Sequence CACTCGGAACAGCTGGACCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 158}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987066293_987066296 -3 Left 987066293 5:14293121-14293143 CCATGAACTGTATGGTAAGACAC 0: 1
1: 0
2: 0
3: 5
4: 74
Right 987066296 5:14293141-14293163 CACTCGGAACAGCTGGACCCTGG 0: 1
1: 0
2: 1
3: 13
4: 158
987066291_987066296 30 Left 987066291 5:14293088-14293110 CCATGGAGCTTCAGACGCAGCAC 0: 1
1: 0
2: 1
3: 19
4: 155
Right 987066296 5:14293141-14293163 CACTCGGAACAGCTGGACCCTGG 0: 1
1: 0
2: 1
3: 13
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987066296 Original CRISPR CACTCGGAACAGCTGGACCC TGG Intronic
902638753 1:17752513-17752535 CAATGGGAACAGTTGGAACCAGG + Intergenic
903016183 1:20363622-20363644 CAGTAGGAGCAGCTGGAACCTGG - Intergenic
903595365 1:24490058-24490080 CACTCAGAGCAGCTGGCCCGAGG + Intergenic
904464637 1:30700568-30700590 AGCTCAGCACAGCTGGACCCAGG + Intergenic
905168751 1:36098258-36098280 CAATAGGGCCAGCTGGACCCTGG + Exonic
905880947 1:41463474-41463496 ATCAAGGAACAGCTGGACCCAGG - Intergenic
906563522 1:46778780-46778802 CACTGGGAGCAGCCGGCCCCGGG - Intronic
910942339 1:92550294-92550316 CAATGAGAACAGCTGGACACGGG + Intronic
911139574 1:94484583-94484605 CAATGAGAACACCTGGACCCAGG + Intronic
911516656 1:98875824-98875846 CAATGAGAACACCTGGACCCAGG - Intergenic
914388016 1:147190877-147190899 CAATCAGAACAGATGGACACAGG - Intronic
914812483 1:151038984-151039006 GACTCGGAGCAGCTGGACAGTGG + Exonic
915528662 1:156490957-156490979 CAGTGGGAAGTGCTGGACCCTGG - Intronic
1064586007 10:16840013-16840035 CAATCGGAACACATGGACACAGG + Intronic
1069630328 10:69893678-69893700 CAGTGGAAACAGCTGGACCTTGG + Intronic
1071294914 10:84212442-84212464 CTCTTGGAGCTGCTGGACCCAGG - Intronic
1071879340 10:89878070-89878092 CTCTTGCCACAGCTGGACCCTGG - Intergenic
1074282032 10:112061687-112061709 TACTCGGAAAAGCTGTCCCCAGG + Intergenic
1074869615 10:117566456-117566478 GTCTCAGAACACCTGGACCCTGG + Intergenic
1076372716 10:129965247-129965269 CCCTCGGAGCCGCCGGACCCGGG + Intergenic
1076742322 10:132492735-132492757 CAGTGGGAACAGCTGGAGCCAGG - Intergenic
1077053619 11:579194-579216 CACTCGGGACAGTTGGACCCTGG + Intronic
1077408612 11:2393411-2393433 CACCTGGGACAGCTGGACCAGGG - Intronic
1077844895 11:6013421-6013443 CACTCCCAACAGCTGGGCCTGGG - Intergenic
1078305364 11:10179141-10179163 CAATGAGAACAGCTGGACACAGG + Intronic
1080471826 11:32553221-32553243 CACATGGAACAGCTATACCCTGG - Intergenic
1082105472 11:48216857-48216879 CACTCTGCACAGCTGGATCCTGG - Exonic
1082814928 11:57501363-57501385 CACCAGGAACAGCTGGGCACAGG + Intronic
1088420083 11:109635937-109635959 CACTGGGAAGACCTGGAGCCTGG + Intergenic
1090264099 11:125343178-125343200 CACTGGCAAAAGCGGGACCCAGG + Intronic
1093181006 12:15966901-15966923 CACCAGGACCACCTGGACCCGGG + Intronic
1094481562 12:30886242-30886264 CACTCTGAGCACCTGTACCCTGG + Intergenic
1095484487 12:42671227-42671249 CACTAGTAACAGCTTGAGCCAGG - Intergenic
1097208220 12:57342402-57342424 CTCTCTGAACAGCTGGGCCATGG - Intronic
1097759378 12:63444092-63444114 CACTGAGAACACATGGACCCAGG - Intergenic
1098594881 12:72260474-72260496 CACTGGGAGCAACTGGACACGGG + Intronic
1100385793 12:94103579-94103601 CATTCGGCATAGCTGGACCATGG + Intergenic
1100432960 12:94546847-94546869 GACTCTGGACAGCTGGTCCCAGG + Intergenic
1101721636 12:107355369-107355391 CACGTGGAACAGCTGGTGCCTGG + Intronic
1101861653 12:108487057-108487079 CAATGAGAACAGCTGGACACAGG - Intergenic
1104198741 12:126567137-126567159 CACTTGGAGCAGCCGGCCCCAGG + Intergenic
1108393850 13:49974119-49974141 CTCTCTTAACAGCTGAACCCTGG + Intergenic
1109506141 13:63305832-63305854 CACTCGGAGCGGCGGGCCCCGGG + Intergenic
1109676678 13:65685325-65685347 CAATGGGAACACCTGGACACAGG - Intergenic
1111367717 13:87271345-87271367 CAATGAGAACAGCTGGACACAGG + Intergenic
1112562560 13:100527039-100527061 AACTGGGAACAGCTCGGCCCTGG - Intronic
1113349831 13:109518443-109518465 CACTCCCAAAAGCTGGACCTTGG - Intergenic
1113783743 13:112991064-112991086 CCCACAGAGCAGCTGGACCCAGG - Intronic
1114055509 14:18964631-18964653 CACTGGGACCAGATGGAGCCAGG + Intergenic
1114107036 14:19437132-19437154 CACTGGGACCAGATGGAGCCAGG - Intergenic
1118407582 14:65441991-65442013 CAATGAGAACAACTGGACCCAGG - Intronic
1119531431 14:75364064-75364086 CTTTAGGAACAGCTGGATCCAGG + Intergenic
1121382339 14:93483733-93483755 CACTGAGAACACCTGGACCCAGG - Intronic
1124186010 15:27530173-27530195 CAATTGGAACAGCTTGCCCCAGG - Intronic
1127960326 15:63885693-63885715 CACTCAGAACAGGTTGCCCCAGG + Intergenic
1129683302 15:77670736-77670758 GACTCGGTGCAGCAGGACCCAGG + Intronic
1130257348 15:82331956-82331978 CACTGGGATTAGCAGGACCCTGG - Intergenic
1130597597 15:85258033-85258055 CACTGGGATTAGCAGGACCCTGG + Intergenic
1132251716 15:100340274-100340296 CACCCGGAACAGGTGCTCCCAGG - Intronic
1133335363 16:5003569-5003591 CACTGGTAAGAGCTGGAGCCTGG + Exonic
1137620102 16:49870497-49870519 CTGTCAGGACAGCTGGACCCTGG - Intergenic
1138357746 16:56397475-56397497 CAATGAGAACAGCTGGACACAGG + Intronic
1139053431 16:63153077-63153099 CAATGGGAACAGATGGACACAGG + Intergenic
1140728524 16:77835443-77835465 GACTCAGCACAGCTGGACCATGG - Intronic
1142495520 17:304578-304600 CACTCTGAGCAGCTGGTGCCTGG + Intronic
1142843530 17:2653217-2653239 CAATGAGAACAGCTGGACACAGG + Intronic
1143502669 17:7348202-7348224 CACCGGGAGCAGCTGGGCCCTGG - Exonic
1144762884 17:17717328-17717350 CCATGGGAACAGCTGGGCCCAGG - Intronic
1146055070 17:29576862-29576884 CACTCGGAGCAACCGGGCCCGGG - Exonic
1147548117 17:41418949-41418971 CAGTCAGGACACCTGGACCCTGG - Intergenic
1152605486 17:81287505-81287527 GACGCGGAGCAGCTGGGCCCAGG + Intronic
1153797759 18:8640468-8640490 GACTCGGAGGAGCAGGACCCTGG - Intergenic
1155893349 18:31293302-31293324 CACTCGGGAGAGCTAGATCCTGG - Intergenic
1156034141 18:32748156-32748178 CACTTAGAACAGCTGAAACCAGG - Intronic
1159892351 18:73964557-73964579 TACATGGAACAGCTGGGCCCTGG + Intergenic
1160018699 18:75164045-75164067 AACTAGGAAGGGCTGGACCCTGG + Intergenic
1160684139 19:425553-425575 CACTGGGAAGCTCTGGACCCTGG - Intronic
1161061980 19:2219833-2219855 CCCTCCCCACAGCTGGACCCCGG + Intronic
1163502121 19:17682459-17682481 CACTCAGGCCTGCTGGACCCAGG + Intronic
1164907538 19:31979563-31979585 CACTCAGAACAGCCAGCCCCAGG + Intergenic
1166869789 19:45864321-45864343 CGCTCGGGACAGCCGTACCCCGG + Exonic
925409399 2:3631467-3631489 CACTGGGCACAGCTGGGCCTGGG - Intronic
926247380 2:11131414-11131436 CACTCAGAAAAGCCTGACCCAGG + Intergenic
928450462 2:31373870-31373892 CACTTGGAAGAGCTGGACATCGG + Exonic
929890890 2:45917948-45917970 CACTCGGAGCAGCCGGCCGCCGG - Intronic
933776165 2:85772429-85772451 CGCTCGGAACATCTGGAGTCTGG - Intronic
934514927 2:94980717-94980739 CAGTCGGACCTGCTGGACCCGGG + Intergenic
935939218 2:108221080-108221102 CACTGGGCACAGCAGGACACGGG + Intergenic
936947096 2:117940867-117940889 CACACGGAACATCGTGACCCTGG - Intronic
939972555 2:148678662-148678684 CACTCGGAGCAGCCGGCCCCAGG - Intronic
941839660 2:170067142-170067164 CACTGTTAACATCTGGACCCAGG + Intronic
944729625 2:202503469-202503491 CACTCGGAGCAGCCAGCCCCGGG + Intronic
947323234 2:228946188-228946210 CCCTTGAAACAGCTGGACTCAGG - Intronic
1171082371 20:22200065-22200087 CAATCGGAACACTTGGACACAGG + Intergenic
1173367998 20:42405386-42405408 CAATGAGAACAGGTGGACCCAGG - Intronic
1176909102 21:14541078-14541100 CAATGGGAACATCTGGACACAGG + Intronic
1178925719 21:36773368-36773390 CACTGGGAGCAGCTGGCCTCTGG + Intronic
1179885077 21:44310403-44310425 CACTCGGGTCCCCTGGACCCAGG + Intronic
1180473987 22:15687183-15687205 CACTGGGACCAGATGGAGCCAGG + Intergenic
1181670310 22:24422802-24422824 CATTGGGCACAGCTGGACACTGG + Intronic
1184213753 22:43052629-43052651 TACTCGGGACAGCTGGAGGCTGG + Intronic
1185242575 22:49754613-49754635 CACTGGGCACAGCTGGGGCCTGG - Intergenic
950178525 3:10894164-10894186 CAGTGGGAGCAGCAGGACCCAGG - Intronic
950650431 3:14403616-14403638 CACTCAGGACTGCTGGACGCTGG - Intronic
951023593 3:17806583-17806605 GACTCAGAAAAGCTGAACCCTGG + Intronic
953864634 3:46573628-46573650 CTCTCAGAACAGCTGGAAGCTGG + Intronic
959953343 3:112206790-112206812 CAATCAGAACACCTGGACACAGG + Intronic
960936061 3:122903402-122903424 GGCTCAGAACAGCTGGGCCCTGG + Intergenic
961479187 3:127168565-127168587 AACTCAGAGCAGCTGGCCCCAGG - Intergenic
963270280 3:143279608-143279630 CAATGGGAACACATGGACCCAGG - Intronic
964240970 3:154594294-154594316 CAATCAGAACACCTGGACACAGG - Intergenic
965120482 3:164548419-164548441 CAATGGGAACACTTGGACCCAGG + Intergenic
967052481 3:185797674-185797696 CAGGCGGATCAGCTGGGCCCAGG + Intronic
968510189 4:992189-992211 GACACGGAGCAGCTGGACTCAGG - Intronic
968547188 4:1205364-1205386 TCCTCGGAGCAGCTGCACCCAGG + Intronic
970560177 4:17274775-17274797 CACTAGGAACAGCTGTGTCCTGG + Intergenic
974937551 4:68426121-68426143 CAATGAGAACAGCTGGACACAGG + Intergenic
981625372 4:146748417-146748439 CACTCCAAACACCTGTACCCTGG + Intronic
985732184 5:1555574-1555596 CACTCAGAGGAGCTGGACACGGG - Intergenic
985856694 5:2433912-2433934 CAATAGGAACAGGTGCACCCAGG - Intergenic
987066296 5:14293141-14293163 CACTCGGAACAGCTGGACCCTGG + Intronic
987626390 5:20406380-20406402 CAATCAGAACACCTGGACACAGG + Intronic
987908771 5:24114392-24114414 CAATGAGAACAGCTGGACACAGG - Intronic
988676379 5:33437261-33437283 CAATGGGAACACCTGGACACTGG + Intergenic
988704352 5:33709652-33709674 CACTTGGAACACATGGACCCAGG + Intronic
988946418 5:36206090-36206112 CAATCGGAACACATGGACACAGG + Intronic
990490057 5:56295424-56295446 CACTCGGAGCAGCCGGCCCCGGG + Intergenic
996902321 5:128556564-128556586 CAATGAGAACAGCTGGACCCAGG + Intronic
997885000 5:137622026-137622048 GACTCTGAACAGCAGGACCTTGG - Exonic
1001672710 5:173487436-173487458 CACTGGTAACAACTGGAGCCAGG - Intergenic
1003747997 6:9024365-9024387 CACTCGGAGCAGCCGGGCCCTGG + Intergenic
1005604037 6:27457342-27457364 GAATGGAAACAGCTGGACCCTGG - Exonic
1007123999 6:39409343-39409365 AACTAGTAACAGCAGGACCCTGG - Intronic
1007417573 6:41700933-41700955 CACTGGGACCAGCTGGGCCCTGG + Intronic
1010732423 6:79404981-79405003 CTCTCGCAACAGGTGGAGCCTGG + Intergenic
1018429516 6:163712531-163712553 CTCCCGGAAGAGCTGGACGCTGG - Intergenic
1018548508 6:164964496-164964518 CTGTAGGAACAGCTTGACCCAGG - Intergenic
1019539496 7:1545427-1545449 CACCAGGAACAGCGGGACCTGGG - Exonic
1019813832 7:3184681-3184703 CTCTCGGGACAGCTGGCTCCAGG + Intergenic
1023057817 7:36303867-36303889 TACCAGGAACAGCTGGAGCCTGG - Intergenic
1024223944 7:47310763-47310785 CAATCAGAACACCTGGACACAGG - Intronic
1027216880 7:76189511-76189533 CAGTCGGAACACGGGGACCCAGG + Intergenic
1029114114 7:98228690-98228712 CAGTAGGAACAGAGGGACCCTGG + Intronic
1029790778 7:102840887-102840909 CACTTGGAAGACATGGACCCTGG + Intronic
1032722636 7:134563235-134563257 CAGTGGGAAGAGCTGGAGCCTGG - Intronic
1034998707 7:155594585-155594607 CACCCAGACCAGCTGCACCCAGG + Intergenic
1038377583 8:27058040-27058062 CAATGAGAACAGCTGGACACAGG - Intergenic
1039951817 8:42178920-42178942 CACTCGGAGCGGCGGGCCCCAGG - Exonic
1042948771 8:74179790-74179812 CACTCGGAGCCGCTGGCCCCGGG - Intergenic
1043375433 8:79644244-79644266 CATCAGGAACAGCTGGATCCAGG + Intronic
1048314882 8:133354497-133354519 CACTCAGAACAGCTATACACTGG + Intergenic
1049671710 8:143872969-143872991 CACAGGGAGCAGCTGGCCCCGGG + Exonic
1050083361 9:1938812-1938834 CTCTCCAAACAGCAGGACCCAGG + Intergenic
1050920603 9:11196965-11196987 CACTTGGAGCAGCTGGCCCCGGG + Intergenic
1054796911 9:69310925-69310947 CAGCTGGAACAGCTGGAACCAGG + Intergenic
1056994649 9:91444915-91444937 CACTCAGAGCACCTGGGCCCTGG - Intergenic
1057792014 9:98130781-98130803 CCCTAGGAACACCTGGAGCCAGG - Intronic
1058961908 9:109999489-109999511 CACTGGGAACAGATGGTCCCAGG - Intronic
1059476250 9:114550389-114550411 CACTTGGAACACCTGGAAGCAGG + Intergenic
1060055635 9:120410460-120410482 CTCTGGGAACTGCAGGACCCTGG - Intronic
1061391438 9:130319338-130319360 CACTCAGCACAGGTTGACCCTGG + Intronic
1061863391 9:133479110-133479132 CCCTCGGAGCTGCTGGCCCCGGG - Exonic
1062291701 9:135798207-135798229 CCCTGGGAACAGCCTGACCCTGG + Intergenic
1186968586 X:14815117-14815139 CAATGGGAACAGTTGGACACAGG + Intergenic
1189261167 X:39679786-39679808 CGCTGGGAGCAGCTGGGCCCTGG - Intergenic
1190039619 X:47059300-47059322 TATTGGGAACAGCTGGGCCCAGG + Exonic
1190113267 X:47608918-47608940 CACACGGCACAAATGGACCCTGG + Intronic
1190622106 X:52297717-52297739 CAATTGGAACACATGGACCCAGG + Intergenic
1191702444 X:64057695-64057717 CAATGGGAACACATGGACCCTGG - Intergenic
1191994903 X:67082607-67082629 CAATGAGAACACCTGGACCCAGG - Intergenic
1193127113 X:77881458-77881480 CAGTGAGAACACCTGGACCCAGG - Intronic
1199684172 X:150251417-150251439 CAATGAGAACAGTTGGACCCAGG + Intergenic
1200063743 X:153495187-153495209 CACTGGGGACAGCAGGACCAGGG - Intronic