ID: 987066744

View in Genome Browser
Species Human (GRCh38)
Location 5:14297274-14297296
Sequence TGAACCCCCAGCCCACGAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 152}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987066741_987066744 -5 Left 987066741 5:14297256-14297278 CCGAAAAGGTCAGTGCCTTGAAC 0: 1
1: 0
2: 1
3: 22
4: 167
Right 987066744 5:14297274-14297296 TGAACCCCCAGCCCACGAGGTGG 0: 1
1: 0
2: 1
3: 7
4: 152
987066740_987066744 3 Left 987066740 5:14297248-14297270 CCAGAAGGCCGAAAAGGTCAGTG 0: 1
1: 0
2: 0
3: 7
4: 105
Right 987066744 5:14297274-14297296 TGAACCCCCAGCCCACGAGGTGG 0: 1
1: 0
2: 1
3: 7
4: 152
987066736_987066744 16 Left 987066736 5:14297235-14297257 CCTCCATTTTCCACCAGAAGGCC 0: 1
1: 0
2: 2
3: 16
4: 172
Right 987066744 5:14297274-14297296 TGAACCCCCAGCCCACGAGGTGG 0: 1
1: 0
2: 1
3: 7
4: 152
987066737_987066744 13 Left 987066737 5:14297238-14297260 CCATTTTCCACCAGAAGGCCGAA 0: 1
1: 0
2: 1
3: 6
4: 141
Right 987066744 5:14297274-14297296 TGAACCCCCAGCCCACGAGGTGG 0: 1
1: 0
2: 1
3: 7
4: 152
987066739_987066744 6 Left 987066739 5:14297245-14297267 CCACCAGAAGGCCGAAAAGGTCA 0: 1
1: 0
2: 0
3: 5
4: 111
Right 987066744 5:14297274-14297296 TGAACCCCCAGCCCACGAGGTGG 0: 1
1: 0
2: 1
3: 7
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987066744 Original CRISPR TGAACCCCCAGCCCACGAGG TGG Intronic
900249680 1:1661287-1661309 CGACCCCAGAGCCCACGAGGAGG + Intronic
900260717 1:1727194-1727216 CGACCCCAGAGCCCACGAGGAGG + Intronic
901324667 1:8359327-8359349 ACAGCACCCAGCCCACGAGGGGG + Intronic
901533462 1:9867654-9867676 TGCACCTCCTGCCCACTAGGTGG - Intronic
901815991 1:11793930-11793952 TGGGGCCCCAGCCCACGATGGGG + Exonic
902163842 1:14553666-14553688 GGAGCCCCAAGCCCAAGAGGGGG - Intergenic
902645896 1:17797765-17797787 TGAATCCCCAGCCTTCCAGGTGG + Intronic
903750814 1:25619235-25619257 GACACCCCCAGGCCACGAGGGGG + Intronic
907284957 1:53373722-53373744 TGAAGCCCCAGCCCTCGGTGTGG - Intergenic
911264803 1:95730685-95730707 TGTTCCCTCAGCCCAAGAGGTGG - Intergenic
911747349 1:101454210-101454232 TTAGCCCCCATCCCACCAGGTGG - Intergenic
920194691 1:204219003-204219025 TGAGCCCCCTCCCCAGGAGGAGG - Exonic
920539713 1:206769198-206769220 TCTGTCCCCAGCCCACGAGGAGG + Intronic
922419390 1:225449373-225449395 TGAATGCCCAGCCTAGGAGGTGG - Intergenic
922744248 1:228035483-228035505 GGAACCCCAAGCCCACAGGGAGG + Intronic
1064007196 10:11708085-11708107 TGAACACCCCGCACACGGGGAGG + Intergenic
1069881301 10:71595521-71595543 TGAACCCCAGGCCAACCAGGTGG - Intronic
1070433283 10:76362609-76362631 TGAAGCCCAACCCCACCAGGGGG - Intronic
1072148724 10:92667454-92667476 TGAACCCTGAACCCAGGAGGCGG - Intergenic
1077460789 11:2708439-2708461 GGCACCCACAGCCCCCGAGGAGG + Intronic
1077905641 11:6530732-6530754 TGAACCCCCTGTACAAGAGGAGG - Intronic
1079127800 11:17731210-17731232 TGGCACCCCAGCCCACCAGGAGG + Intergenic
1083203622 11:61134406-61134428 TTAACCCACAGCCCACGAGGTGG + Intronic
1083430374 11:62611205-62611227 TGGACCCCCAGCCCCTCAGGGGG - Exonic
1084505952 11:69568137-69568159 TGCAACCCCAGCCCTGGAGGTGG + Intergenic
1087747382 11:101964548-101964570 TGAACCCAGAGCCCAGGAGGAGG + Intronic
1089711308 11:120316887-120316909 TGCAGCCCCAGACCAAGAGGCGG - Intronic
1089959675 11:122604745-122604767 TGAACCCCCAGCCCACTGCCGGG - Intergenic
1093379877 12:18479411-18479433 TGAATCCCCAGTCCACTGGGTGG + Intronic
1097116134 12:56698683-56698705 TGAACCCAGAACCCAGGAGGCGG - Intergenic
1101745558 12:107538811-107538833 TGAGCCCCCACCCCACAAAGTGG + Intronic
1104256842 12:127146582-127146604 CTAACTCCCAGCCCTCGAGGAGG - Intergenic
1108057319 13:46497776-46497798 TGAGCCCCCATCCCTCTAGGAGG - Intergenic
1109842628 13:67939819-67939841 TGAAGCCCCATCTCACTAGGAGG - Intergenic
1110758930 13:79208521-79208543 TGAACCCCCGGCCCATGCTGTGG + Intergenic
1115754542 14:36518804-36518826 TGGACCCCCAGCCGAGCAGGGGG + Intronic
1119730916 14:76950658-76950680 CGAAGCCCCAGCCCACGTGCAGG + Intergenic
1122069719 14:99197839-99197861 TGCACCCCCAGCCCCAGAAGAGG + Intronic
1122409509 14:101518697-101518719 TGTACACCCGGCCCATGAGGCGG + Intergenic
1122637063 14:103135102-103135124 CCAACGCCCGGCCCACGAGGGGG - Intronic
1125736955 15:41933621-41933643 GGAACCCCCAGCCTAGAAGGTGG - Intronic
1125832122 15:42724427-42724449 TGGACCCCCGCCTCACGAGGAGG - Exonic
1129474127 15:75772713-75772735 TGAACCCAGAACCCAGGAGGTGG - Intergenic
1130187226 15:81695725-81695747 TGAACCCTGAACCCAGGAGGTGG + Intergenic
1130910341 15:88266347-88266369 GGAACCTCCAGCCTGCGAGGGGG + Intergenic
1132354232 15:101159378-101159400 TCCACCCCCAGCCCAGGAAGGGG - Intergenic
1133730169 16:8571999-8572021 TGAACCCTCAGCAAACGAGGGGG - Intronic
1133969754 16:10559153-10559175 TGAACCACCAGCCCCGGAGCAGG - Intronic
1136716645 16:32287847-32287869 TGGACCCCCAGAACACGTGGAGG + Intergenic
1139322112 16:66123140-66123162 TGAACCCTGAACCCAGGAGGTGG + Intergenic
1140504166 16:75459964-75459986 TGGACCTCCAGGCCAGGAGGTGG - Intronic
1141764863 16:86051648-86051670 TCAACAGCCAGCCCAGGAGGAGG - Intergenic
1203145195 16_KI270728v1_random:1794413-1794435 TGGACCCCCAGAACACGTGGAGG + Intergenic
1143398913 17:6627841-6627863 TGAGGGCCCAGCCTACGAGGTGG - Intronic
1144412326 17:15013256-15013278 TGACCCCCCAGCCCAGGTGAAGG + Intergenic
1147774157 17:42888783-42888805 TGGAACCCCAGCTCACAAGGGGG - Intergenic
1147865632 17:43550165-43550187 TGACCCACCAGCCCATGGGGAGG - Intronic
1152123452 17:78432797-78432819 TGAACCCCCAGGCCCTGAGGTGG + Intronic
1152239768 17:79155206-79155228 TGAACACAGAGCCCACAAGGTGG + Intronic
1152272091 17:79330681-79330703 TGATCCCCAAGCCCACATGGTGG - Intronic
1152390875 17:80002999-80003021 TGAATCCCCAGCCCACCTGCAGG - Intronic
1152835181 17:82525254-82525276 TGAACCCAGAACCCAGGAGGCGG - Intronic
1153610242 18:6877440-6877462 GGAAGCCCCAGCCCACGACGGGG - Intronic
1159037254 18:63289635-63289657 TATAACCCCAGCCCTCGAGGAGG + Intronic
1161777794 19:6273232-6273254 AGCAACCCCAGCCCATGAGGAGG + Intronic
1161816550 19:6502757-6502779 GGAGCCCCCAGCCCACTGGGAGG - Intronic
1161905275 19:7151912-7151934 TGAACTCCTAGCCCATGGGGAGG - Intronic
1163739135 19:18999934-18999956 TGCACACCCAGCCCACAAGCAGG + Intronic
1165761620 19:38324846-38324868 TGTAACCCCAGCCCTCTAGGAGG - Intronic
929537460 2:42792616-42792638 AGAATCCCAAGCTCACGAGGCGG + Intergenic
929966008 2:46537240-46537262 TGAAACCCCAGCCCCTGTGGGGG + Intronic
931339325 2:61383621-61383643 TGAACCCCCACCCCCGGGGGGGG + Intronic
931537676 2:63297276-63297298 TGAACCCCCAGCCCACCCCTTGG - Intronic
941846621 2:170140589-170140611 TGTTCCCCCAGCCCTCCAGGCGG + Intergenic
942459395 2:176159151-176159173 TTAATCCCCAGCCAAAGAGGGGG - Intronic
946460397 2:219863576-219863598 TGAATCCCCAGCCTCCCAGGTGG - Intergenic
947948207 2:234124715-234124737 GGGACCCCAAGCCCACTAGGGGG - Intergenic
948721979 2:239906188-239906210 AGAACCCCCGGCCCTCCAGGTGG + Intronic
948795566 2:240400568-240400590 GGGACCCACAGCCCAGGAGGTGG + Intergenic
948947788 2:241229898-241229920 GAAACCCCCAGCACACGAAGAGG - Exonic
1168806831 20:676524-676546 TGAACCCCAAACCCAACAGGGGG - Intergenic
1171055613 20:21903550-21903572 TGATCTCCCAGACCACTAGGAGG + Intergenic
1171382496 20:24744119-24744141 AGATCCCACAGCCCAGGAGGAGG - Intergenic
1172060154 20:32181935-32181957 TGCACCTCCAGCCCTCCAGGTGG - Intergenic
1172296779 20:33817628-33817650 TGAAGCCAGAGCCCACCAGGAGG + Intronic
1173089976 20:39961261-39961283 TGATCCCGCAGCCCCAGAGGAGG + Intergenic
1175121087 20:56716879-56716901 TGAGCCCCCACCCCTGGAGGAGG - Intergenic
1175133609 20:56807293-56807315 TAAACCCCAACTCCACGAGGAGG + Intergenic
1175389479 20:58617620-58617642 TCAACCCTCACCTCACGAGGAGG - Intergenic
1180981055 22:19878204-19878226 TCAGCCACCAGCCCAGGAGGGGG + Intronic
1181407118 22:22692924-22692946 TGAGCCCCCAGCCCACAGTGTGG + Intergenic
1181601808 22:23956927-23956949 TGATCCCCCAGCCCTAGGGGTGG + Intergenic
1181606701 22:23984380-23984402 TGATCCCCCAGCCCTAGGGGTGG - Intergenic
1183212818 22:36461471-36461493 CCAACCCCCACCCCACAAGGAGG - Intergenic
1183257386 22:36771209-36771231 TGCTTCCCCAGCCCAAGAGGTGG + Intronic
1184718564 22:46296091-46296113 TGATCCTCAAGCCCCCGAGGTGG + Intergenic
950927947 3:16761332-16761354 TGAACACCCAGGACAGGAGGTGG - Intergenic
953186861 3:40646123-40646145 TGCTCCACCAGCCCAGGAGGAGG + Intergenic
954139881 3:48599372-48599394 TGAAGCCCCACCCCACATGGAGG + Intronic
955399448 3:58581166-58581188 TGATGCCCCAGCTCACCAGGGGG - Intronic
959932437 3:111999083-111999105 TGAACCCCCAGGCAGCAAGGGGG - Exonic
961598869 3:128043239-128043261 TGACCCCGAAGCCCAAGAGGGGG + Intergenic
962103696 3:132369253-132369275 TGAACCCCCAGCCATCCAGTTGG + Intergenic
962164950 3:133038713-133038735 TGAACCCCCTCCCCAGGTGGAGG + Intronic
965492404 3:169354790-169354812 TGAAGCCCCAGCTCAGGAAGGGG - Intronic
968627117 4:1630768-1630790 TGAGCCCCCTCCCCACGAGTGGG - Intronic
969214793 4:5712890-5712912 TTATCCTCCAGCCCATGAGGTGG + Intronic
969238101 4:5881028-5881050 ACCACCCCCAGCCCAGGAGGAGG + Intronic
970573641 4:17406673-17406695 TGAGCCCCCAGCCACAGAGGTGG + Intergenic
970876708 4:20879089-20879111 TGAACCTCCATCCCAGGATGCGG - Intronic
976390098 4:84497992-84498014 TGAAGCCCCCGGCCACGGGGGGG - Exonic
984708926 4:182868496-182868518 TGAACCCAGTGCCCATGAGGAGG - Intergenic
986735003 5:10662028-10662050 TGCACTCACAGCCCAGGAGGAGG + Intergenic
987066744 5:14297274-14297296 TGAACCCCCAGCCCACGAGGTGG + Intronic
989710128 5:44388299-44388321 TCCACCCCCAGCCCACACGGGGG - Intronic
995475895 5:112547917-112547939 TGAACCCACAGGCAAAGAGGAGG + Intergenic
996853887 5:127983105-127983127 TGAAGCCCCAGACCTCGGGGGGG - Intergenic
997643489 5:135465305-135465327 TGAAACCACAGCCCACAAAGGGG - Intergenic
1001245874 5:170105765-170105787 TCAGCCTCCAGCCCACGGGGAGG - Intergenic
1006832403 6:36976774-36976796 TGAGCCCCAAGCCCATGGGGTGG + Intronic
1007390225 6:41546474-41546496 GGAGCCCCCAGCCCGCGAGGAGG + Exonic
1007427496 6:41756911-41756933 TGAATCCCCAGCCCTCCAAGGGG + Intergenic
1012457600 6:99424878-99424900 TGAACCCCCTTCCCACAAGGGGG + Intronic
1012910642 6:105113729-105113751 TGAAATCCCAGCACCCGAGGCGG + Intronic
1012994916 6:105963696-105963718 TGTACCCCCAACCCACCAGAAGG - Intergenic
1018057916 6:160068457-160068479 ACAACCACCACCCCACGAGGAGG - Intronic
1018057938 6:160068577-160068599 ACAACCACCACCCCACGAGGAGG - Intronic
1019374396 7:681647-681669 AGCAACCCCAGCCCACGTGGAGG - Intronic
1019657046 7:2201411-2201433 GGAGCCCCTAGCCCACAAGGAGG + Intronic
1023640621 7:42253392-42253414 TGTATCCCCATCCCAGGAGGAGG - Intergenic
1023653121 7:42391041-42391063 TGCACCCCCAGCCCACCACCTGG - Intergenic
1024030485 7:45456077-45456099 TGGACCGACAGCCCAGGAGGTGG - Intergenic
1026740685 7:72976533-72976555 TGCACCCCCAGTCCCCGGGGGGG - Intergenic
1027103047 7:75388538-75388560 TGCACCCCCAGTCCCCGGGGGGG + Intergenic
1029020485 7:97359771-97359793 CGAAACCCCATCCCAGGAGGTGG - Intergenic
1034303640 7:150035376-150035398 AGGACCCCCATCGCACGAGGGGG - Intergenic
1034304093 7:150037076-150037098 AGGACCCCCATCGCACGAGGGGG - Intergenic
1034304237 7:150037544-150037566 AGGACCCCCATCGCACGAGGGGG - Intergenic
1035272925 7:157731026-157731048 TGAACTCCCAGCCCTGGACGAGG + Intronic
1039390647 8:37178504-37178526 TGAACTTCCAGGCCATGAGGTGG + Intergenic
1042991630 8:74646804-74646826 TGAATCCCCAGCTCCCCAGGAGG + Intronic
1049197364 8:141323109-141323131 TGAACCCCAGGCCCACCTGGAGG + Intergenic
1049243616 8:141550684-141550706 AGAGACCCCAGCCCACCAGGCGG - Intergenic
1049243660 8:141550807-141550829 AGAGACCCCAGCCCACCAGGCGG - Intergenic
1049243676 8:141550848-141550870 AGAGACCCCAGCCCACCAGGCGG - Intergenic
1049243737 8:141551012-141551034 AGAGACCCCAGCCCACCAGGCGG - Intergenic
1049243824 8:141551258-141551280 AGAGACCCCAGCCCACCAGGCGG - Intergenic
1049432890 8:142573521-142573543 TGCAGCCCCAGGCCATGAGGAGG + Intergenic
1049655104 8:143793803-143793825 TGACCCCCCATCCCTGGAGGAGG + Intronic
1049694550 8:143976962-143976984 TGAGCCCCCGGCGCACGGGGCGG + Intergenic
1049696487 8:143986555-143986577 TCAACCCCCAGCTGACCAGGAGG + Intronic
1049748163 8:144271747-144271769 CGAACCCCCAGCCCAAGGTGGGG + Intronic
1056732418 9:89177947-89177969 AGAACCCCCAGCCCCCAGGGCGG + Intronic
1057915639 9:99053251-99053273 TGTCACCCCGGCCCACGAGGTGG + Intronic
1061265985 9:129505362-129505384 TGAGCCCCCAGCGCACGCCGCGG - Intergenic
1061934389 9:133849334-133849356 AGAACTCCCGGCCCAGGAGGAGG - Intronic
1062518967 9:136949802-136949824 TGGACCCCCAGCCCACCGTGGGG - Intronic
1185460960 X:332637-332659 TGGACCCCCAGAACACGTGGAGG + Intergenic
1185780403 X:2839306-2839328 TGAACCCCAAGCCAACAAAGAGG - Intronic
1194668560 X:96702965-96702987 TGAACCCCCACCCCATGTGATGG - Intronic
1201289657 Y:12410671-12410693 TGAACCCCAAGCCAACAAGGAGG + Intergenic