ID: 987068728

View in Genome Browser
Species Human (GRCh38)
Location 5:14315508-14315530
Sequence GCCTGTAATCCCAGCACTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1038702
Summary {0: 215700, 1: 270647, 2: 186590, 3: 142154, 4: 223611}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987068728_987068735 20 Left 987068728 5:14315508-14315530 CCCAAAGTGCTGGGATTACAGGC 0: 215700
1: 270647
2: 186590
3: 142154
4: 223611
Right 987068735 5:14315551-14315573 TGCTTACTAGAAACTCAAAGAGG No data
987068728_987068730 -5 Left 987068728 5:14315508-14315530 CCCAAAGTGCTGGGATTACAGGC 0: 215700
1: 270647
2: 186590
3: 142154
4: 223611
Right 987068730 5:14315526-14315548 CAGGCGAGAGACACCACACCCGG 0: 3
1: 96
2: 6044
3: 38049
4: 120116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987068728 Original CRISPR GCCTGTAATCCCAGCACTTT GGG (reversed) Intronic
Too many off-targets to display for this crispr