ID: 987068729

View in Genome Browser
Species Human (GRCh38)
Location 5:14315509-14315531
Sequence CGCCTGTAATCCCAGCACTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 988408
Summary {0: 121435, 1: 268139, 2: 223994, 3: 153979, 4: 220861}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987068729_987068735 19 Left 987068729 5:14315509-14315531 CCAAAGTGCTGGGATTACAGGCG 0: 121435
1: 268139
2: 223994
3: 153979
4: 220861
Right 987068735 5:14315551-14315573 TGCTTACTAGAAACTCAAAGAGG No data
987068729_987068730 -6 Left 987068729 5:14315509-14315531 CCAAAGTGCTGGGATTACAGGCG 0: 121435
1: 268139
2: 223994
3: 153979
4: 220861
Right 987068730 5:14315526-14315548 CAGGCGAGAGACACCACACCCGG 0: 3
1: 96
2: 6044
3: 38049
4: 120116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987068729 Original CRISPR CGCCTGTAATCCCAGCACTT TGG (reversed) Intronic
Too many off-targets to display for this crispr