ID: 987068735

View in Genome Browser
Species Human (GRCh38)
Location 5:14315551-14315573
Sequence TGCTTACTAGAAACTCAAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987068724_987068735 29 Left 987068724 5:14315499-14315521 CCTCGGCCTCCCAAAGTGCTGGG 0: 114360
1: 259489
2: 214307
3: 130302
4: 170463
Right 987068735 5:14315551-14315573 TGCTTACTAGAAACTCAAAGAGG No data
987068728_987068735 20 Left 987068728 5:14315508-14315530 CCCAAAGTGCTGGGATTACAGGC 0: 215700
1: 270647
2: 186590
3: 142154
4: 223611
Right 987068735 5:14315551-14315573 TGCTTACTAGAAACTCAAAGAGG No data
987068726_987068735 23 Left 987068726 5:14315505-14315527 CCTCCCAAAGTGCTGGGATTACA 0: 288135
1: 266162
2: 155564
3: 133776
4: 191789
Right 987068735 5:14315551-14315573 TGCTTACTAGAAACTCAAAGAGG No data
987068729_987068735 19 Left 987068729 5:14315509-14315531 CCAAAGTGCTGGGATTACAGGCG 0: 121435
1: 268139
2: 223994
3: 153979
4: 220861
Right 987068735 5:14315551-14315573 TGCTTACTAGAAACTCAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987068735 Original CRISPR TGCTTACTAGAAACTCAAAG AGG Intronic
No off target data available for this crispr