ID: 987070434

View in Genome Browser
Species Human (GRCh38)
Location 5:14332212-14332234
Sequence CTGGATAATAACTTTGTGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 132}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987070434 Original CRISPR CTGGATAATAACTTTGTGAC AGG (reversed) Intronic
903100699 1:21026647-21026669 CAGGATATTAACTTTTTAACAGG - Intronic
903411102 1:23143597-23143619 CTGGATAAAACCTTTGCGCCAGG + Intronic
903503278 1:23814092-23814114 CAGGATAAGAAGTTTGTGGCAGG + Intronic
904635236 1:31875159-31875181 CTGCATAATAACATGGTGAAAGG + Intergenic
905213995 1:36393903-36393925 CTGGATGACCTCTTTGTGACAGG - Exonic
908019455 1:59885506-59885528 CTGGATATTATATTTGTAACAGG + Intergenic
913561968 1:120030499-120030521 CTGGATCCTAATTTTGTGCCTGG - Intronic
913636158 1:120763094-120763116 CTGGATCCTAATTTTGTGCCTGG + Intergenic
914282552 1:146189893-146189915 CTGGATCCTAATTTTGTGCCTGG - Intronic
914543582 1:148640609-148640631 CTGGATCCTAATTTTGTGCCTGG - Intronic
914623040 1:149430400-149430422 CTGGATCCTAATTTTGTGCCTGG + Intergenic
915804643 1:158831848-158831870 CTGGAGGATGACTTGGTGACTGG + Intronic
919994744 1:202738958-202738980 TTGGATAATTACTTTGGAACTGG + Intronic
923287362 1:232509196-232509218 CTGTTGAATAACTTTGTGAAAGG - Intronic
1065743907 10:28821462-28821484 CTGGACAATAACTTGGTACCTGG - Intergenic
1066481853 10:35803988-35804010 CTGGGTAGTAAGATTGTGACTGG - Intergenic
1067667887 10:48294133-48294155 TTGGATCCTAACATTGTGACTGG - Intergenic
1079910583 11:26304924-26304946 CTGCATTATGACTTTGTGAAAGG + Intergenic
1085937560 11:81167898-81167920 TTGAATAATTACTTTGTGACTGG + Intergenic
1087430844 11:98052656-98052678 CTGAATATTAACTATATGACAGG + Intergenic
1087657860 11:100947548-100947570 TTGGATATTTACTATGTGACAGG - Intronic
1092739906 12:11617824-11617846 CTTGTTAACAAATTTGTGACAGG - Intergenic
1098386494 12:69925005-69925027 CTGGATCATGAGTTTGTGGCAGG - Intronic
1099230008 12:80012828-80012850 CTGGATATAAAATTTGTGATTGG + Intergenic
1099978736 12:89573890-89573912 CTGGGTATTAATTTTGTGAGAGG + Intergenic
1100738631 12:97566301-97566323 CTGGATATTGACTCTGTCACCGG + Intergenic
1103023083 12:117552211-117552233 CTGGATATTAACTATGGGCCAGG + Intronic
1107361370 13:39620813-39620835 CTGGATACAAAATTTGTGATTGG - Intergenic
1110198586 13:72820667-72820689 CTGGATCATTTCTGTGTGACTGG - Intronic
1110424397 13:75349993-75350015 CTAGATTAAAACTTTTTGACTGG - Intronic
1115329542 14:32181145-32181167 CTAGATAATAACATTATGACAGG - Intergenic
1115530288 14:34320829-34320851 CTTGATTACAACCTTGTGACAGG - Intronic
1115941961 14:38619752-38619774 CAGGCTAAAAACTTTATGACAGG + Intergenic
1117273071 14:54164682-54164704 CTGGAGAATAACTCTGAGGCTGG - Intergenic
1124449173 15:29769823-29769845 CTTGATAATGACTATGTTACTGG + Intronic
1127954521 15:63841667-63841689 CTTTATAATAACCTTGTGAATGG - Intergenic
1128034460 15:64511675-64511697 CTGGATAAAATCTTTGTGGCTGG + Intronic
1128220024 15:65962544-65962566 CTGAACAAAAACTTTGTGCCAGG + Intronic
1129060728 15:72858497-72858519 CTTGATAAGAGCTTTGTGAGAGG + Intergenic
1131728473 15:95253188-95253210 CTGGATGCTAACTGTGTGCCAGG - Intergenic
1134235329 16:12460608-12460630 CTGGACTATAACTTTTTGGCTGG + Intronic
1136739305 16:32500323-32500345 CTGAGAAATAACTTTGTGATAGG + Intergenic
1140867240 16:79073969-79073991 TTGGCAAATAACTTTGTGAAGGG - Intronic
1141252436 16:82370542-82370564 CTGGATGATCACTTTGTGCTGGG + Intergenic
1141347607 16:83261605-83261627 CTGGATAATTTCTTTGTCATGGG - Intronic
1141429657 16:83965135-83965157 CTGGGGCATAACTTTGTGTCCGG + Exonic
1203013908 16_KI270728v1_random:331469-331491 CTGAGAAATAACTTTGTGATAGG - Intergenic
1203032243 16_KI270728v1_random:604628-604650 CTGAGAAATAACTTTGTGATAGG - Intergenic
1148144964 17:45358322-45358344 CAGGAGAATATCTTTGGGACTGG - Intergenic
1149045417 17:52239233-52239255 CCGGCTAATAACTTTTTCACAGG + Intergenic
1149194520 17:54103060-54103082 CTGGATATTAACCTAGTTACAGG + Intergenic
1155665469 18:28302947-28302969 CTAGATAACAACATTATGACAGG + Intergenic
1157062659 18:44310678-44310700 CTAGCTAATAACTCTATGACAGG - Intergenic
1159877451 18:73828254-73828276 CTGAATGCTCACTTTGTGACTGG - Intergenic
1159891549 18:73958025-73958047 CTTGAGAAAAACTTTGTGAATGG + Intergenic
1161192708 19:2967774-2967796 CTGTAGAATAAGGTTGTGACGGG - Intergenic
1164888207 19:31801164-31801186 CTGGATATTAGCTCTGTCACAGG - Intergenic
1165249824 19:34520982-34521004 CTTGATGATAACTCTGTCACTGG - Intergenic
1166664354 19:44669850-44669872 CTGGATCATAATTGTGTGAGAGG + Intronic
1167207982 19:48115433-48115455 TTGGATAGCTACTTTGTGACAGG - Exonic
926267133 2:11334110-11334132 ATAGATAAGAACTTAGTGACAGG + Intronic
927576475 2:24205794-24205816 CTGGATACTTACTTTGTGTTAGG + Intronic
928220086 2:29396210-29396232 CTGGATAATAACGCTGTTGCAGG + Intronic
931423098 2:62146205-62146227 CTTGATAATAAGTGTGTTACTGG + Intronic
932247849 2:70211518-70211540 CTGTAGAATATCTTTGTGTCAGG - Exonic
943217379 2:185056068-185056090 CTGAATTAAAACTGTGTGACTGG + Intergenic
943670832 2:190658752-190658774 CTGAATACTTACTTTGTGCCAGG - Intronic
947081930 2:226408599-226408621 CGTGGTAATAACTTTGTGATAGG - Intergenic
949028250 2:241776320-241776342 CTGGACAATAAGTTTGAAACAGG - Intergenic
1168998262 20:2148274-2148296 TTGGAAACTAACTTTGTGCCTGG - Exonic
1170339068 20:15302958-15302980 CTTCATAATAACTTTGTAAAGGG - Intronic
1175309413 20:58001308-58001330 CTGGCTCTTACCTTTGTGACAGG + Intergenic
1175793738 20:61758321-61758343 CTGAGTAATTACGTTGTGACTGG - Intronic
1176839903 21:13830754-13830776 CTGGAGAATATATTTGTGAGTGG + Intergenic
1177395468 21:20530090-20530112 CTGGAATATAACTTTGTGGATGG - Intergenic
1178795854 21:35743638-35743660 CTGCACAATAACTTTCTAACTGG + Intronic
1182756178 22:32681407-32681429 CTGGATATTTACCTTGTGCCTGG + Intronic
1183712084 22:39510911-39510933 CTGCATTATAACATTGTGAAGGG + Intronic
954786015 3:53092946-53092968 TTGGATGCTAACTCTGTGACAGG + Intronic
954975830 3:54693479-54693501 CTTGATGATAACTATGTTACTGG + Intronic
955231202 3:57100362-57100384 CTGTACAATAACTGTGTGATTGG - Intronic
957515690 3:81247959-81247981 CTTGATAATAACTATGTTACTGG + Intergenic
958060645 3:88475544-88475566 CTGGATAATTATTTGGTTACGGG - Intergenic
958599152 3:96271797-96271819 CTGGATATTAACTCTTTGTCAGG + Intergenic
960379445 3:116941118-116941140 CTGGATACAAAATTTTTGACTGG - Intronic
961126506 3:124423370-124423392 CTGAATATTAACTTTGTGTCAGG - Intronic
962656764 3:137554494-137554516 CTGGCTAATAACTTCATGATAGG + Intergenic
963617752 3:147564136-147564158 CTGCATACTATCTTTGTCACAGG + Intergenic
964572470 3:158123677-158123699 CTGGTTCATAACTTAGTGATTGG - Intronic
967456530 3:189693046-189693068 CAGGAGAATAACTATGTTACAGG + Intronic
971560437 4:28073318-28073340 CTGGTTAAAAACTTTGGGCCAGG - Intergenic
974209770 4:58756349-58756371 TTTGATGACAACTTTGTGACAGG + Intergenic
980377478 4:131968323-131968345 CTGAATAATGAGTTTGTGGCCGG + Intergenic
980539391 4:134174356-134174378 CTTGATAATAAATATGTTACTGG - Intergenic
982390600 4:154859119-154859141 CTGGAGAATAACTTTGAAAGGGG + Intergenic
982716346 4:158812505-158812527 CTGGTTTAAAAATTTGTGACAGG - Intronic
983337031 4:166409358-166409380 GTGGATGGTAACTTTGTGTCAGG + Intergenic
983910230 4:173230708-173230730 CTGGATAAGTACTCTGTGAGGGG + Intronic
987070434 5:14332212-14332234 CTGGATAATAACTTTGTGACAGG - Intronic
988842816 5:35099458-35099480 CTTGATAATAACTATGTTACTGG + Intronic
989733724 5:44678073-44678095 GTGAATAATAAGTTTGTGGCTGG - Intergenic
996488856 5:124068504-124068526 GTGAATAATAAATTTGTGAAGGG - Intergenic
996988388 5:129597532-129597554 CGGGATAATACCTTTGTTATGGG + Intronic
1003996443 6:11545655-11545677 CTTGATAACAACTGTGTTACTGG + Intronic
1004295649 6:14407434-14407456 CTGGAAAATGGCTTTGTGGCTGG - Intergenic
1004925700 6:20413187-20413209 CTGGATTATTTCTTTTTGACAGG - Intronic
1005190727 6:23219678-23219700 TTGGGAAATAACTTTGTAACGGG + Intergenic
1012187000 6:96230974-96230996 TTGAATCATAACTTTGTGTCAGG - Intergenic
1012746938 6:103103353-103103375 CTGGCTAACAACATGGTGACAGG - Intergenic
1017655867 6:156629074-156629096 CTTGATAATAAATATGTTACTGG + Intergenic
1019683685 7:2367766-2367788 CTGGTTAAGAACTGAGTGACAGG - Intronic
1021254540 7:18375010-18375032 CTTGATAATAATTATGTTACTGG + Intronic
1023669161 7:42558008-42558030 ATGGAAAATAACCTTGAGACAGG - Intergenic
1025024970 7:55509035-55509057 ATTGATAATAAATTTGAGACAGG - Intronic
1025550883 7:62247279-62247301 CTGAGAAATAACTTTGTGATAGG + Intergenic
1027362809 7:77427100-77427122 CTGCATATGAACTTGGTGACAGG - Intergenic
1027739292 7:81979847-81979869 CTGAATAAATACTTGGTGACTGG - Intronic
1027936941 7:84617927-84617949 CTGGAATCTTACTTTGTGACAGG + Intergenic
1030428882 7:109416646-109416668 CTGGATATTAACCTTTTGTCAGG + Intergenic
1031321044 7:120328292-120328314 TTGGATATTAACTTTGTGCTAGG + Intronic
1035820737 8:2589079-2589101 CTTGAAAACAACTTTGTAACGGG + Intergenic
1036290833 8:7488371-7488393 CAGAAAAATATCTTTGTGACTGG + Intronic
1036330657 8:7823166-7823188 CAGAAAAATATCTTTGTGACTGG - Intronic
1037216935 8:16465942-16465964 CTTGATATTAACTATATGACAGG - Intronic
1037489631 8:19385900-19385922 CTTGAAAATCCCTTTGTGACAGG - Intronic
1041195390 8:55396635-55396657 CTGGATATTGACTTTAGGACAGG + Intronic
1041352441 8:56961529-56961551 CTAGATAATGACTTTGTGAAGGG - Exonic
1044392460 8:91667666-91667688 CTTGAAAATAACTTTGAGATTGG - Intergenic
1047706381 8:127503717-127503739 ATGGTTAGTAACTTGGTGACAGG + Intergenic
1049127175 8:140802011-140802033 CTGGATAATGACTATGTTACTGG + Intronic
1050718150 9:8553602-8553624 CTGGAGTATACCTTTATGACAGG + Intronic
1051325209 9:15959570-15959592 CTAGATAATAATTTTGACACAGG - Intronic
1052962084 9:34307364-34307386 CTGGAGAATAATTTTTTTACTGG + Intronic
1053392696 9:37746964-37746986 CTGGATACTTCCTTTGTGCCAGG + Intronic
1055543658 9:77343198-77343220 ATGGATAAAAGCTTTGGGACAGG + Intronic
1057478217 9:95423199-95423221 ATGGATATTAAATCTGTGACTGG - Intergenic
1058066889 9:100558660-100558682 TTGGATAATAATTTTGTCAATGG + Intronic
1194973659 X:100371790-100371812 CTTGATAAACACTTTGTGCCAGG - Intronic
1198606487 X:138344295-138344317 CTGAAAAAGAAGTTTGTGACTGG + Intergenic
1198993671 X:142547435-142547457 CTGGATAATATCTTCGTAAGAGG + Intergenic
1200771076 Y:7125991-7126013 CTGGAAAATATCTGTGTGTCTGG + Intergenic