ID: 987073698

View in Genome Browser
Species Human (GRCh38)
Location 5:14360758-14360780
Sequence GTGGCCAAGCAAAGGCATCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 145}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987073698_987073703 24 Left 987073698 5:14360758-14360780 CCTGGATGCCTTTGCTTGGCCAC 0: 1
1: 0
2: 2
3: 8
4: 145
Right 987073703 5:14360805-14360827 TCGTTAACAACAGACCTTCTTGG 0: 1
1: 0
2: 0
3: 6
4: 56
987073698_987073700 -7 Left 987073698 5:14360758-14360780 CCTGGATGCCTTTGCTTGGCCAC 0: 1
1: 0
2: 2
3: 8
4: 145
Right 987073700 5:14360774-14360796 TGGCCACTTGTCTAAGTCTCCGG 0: 1
1: 0
2: 0
3: 13
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987073698 Original CRISPR GTGGCCAAGCAAAGGCATCC AGG (reversed) Intronic
901588861 1:10322268-10322290 GTGGACAAGCACATGCACCCTGG + Intronic
902490566 1:16777981-16778003 CTGGCCAAGCAGAGACCTCCGGG + Intronic
903858584 1:26351902-26351924 CTGGCCCAGGAGAGGCATCCTGG - Intronic
905426371 1:37888265-37888287 GTGGCTGAGCAATGGTATCCAGG - Exonic
905765292 1:40595434-40595456 GGGGTCAAGCCAAGGCACCCAGG - Intergenic
905923169 1:41732486-41732508 GTGGCCAAGGAAAGGCCACTGGG + Intronic
905938891 1:41847009-41847031 GTGGCTATATAAAGGCATCCAGG + Intronic
906207998 1:43997242-43997264 GAGGCCACGTAAAGCCATCCAGG + Intronic
907358803 1:53898116-53898138 GTGGCCAAGGGAAAGCTTCCTGG + Intronic
908127582 1:61046420-61046442 GTTGGCAAGCAAAAGCATCATGG + Intronic
909521112 1:76568780-76568802 GTATCAAAGCAAAGTCATCCTGG + Intronic
912211047 1:107557255-107557277 GTGGACAAGCATAGGCTTGCAGG + Intergenic
912515279 1:110212913-110212935 GTGGCCAGCCACAGGCTTCCTGG + Intronic
916525344 1:165604036-165604058 GTGACCAGGCACAGGCATCAGGG - Intergenic
920295349 1:204952873-204952895 GAGGCCAAGCAGAGGCAGCCAGG + Intronic
920603458 1:207353882-207353904 GTGGACAAGTGAAGGCACCCTGG - Intronic
1062988787 10:1795694-1795716 GTGGCCTTGCAGAGGGATCCTGG + Intergenic
1063570942 10:7213966-7213988 GAGGCCAAGAAAAGTCATCTGGG + Intronic
1066022516 10:31318666-31318688 GGGGCCAAGGAAAGGGATCGCGG - Intronic
1066504122 10:36024247-36024269 ATGGCCAAGCAGAGGCAACAAGG - Intergenic
1068828058 10:61462031-61462053 GTGGGTATGCAAAGGCATACAGG + Intergenic
1069580308 10:69561354-69561376 CTGGTCAAGCAAAGGCATGAAGG - Intergenic
1070933476 10:80276654-80276676 GTGGCCAGACACAGGCACCCAGG + Intronic
1074353641 10:112762139-112762161 GTGGCCAAACACTGGCATCGCGG + Intronic
1075345556 10:121679540-121679562 GTGGTCAAGCCCAGGCATGCTGG + Intergenic
1077115591 11:883215-883237 GTGGCGAAGCAAAATCCTCCTGG - Exonic
1077995498 11:7449030-7449052 GTGGAGGAGCAAAGGCATCAAGG + Intronic
1080459237 11:32438929-32438951 CTGGCAAAGCGCAGGCATCCCGG + Intergenic
1082625721 11:55482356-55482378 GAGGTGAAGCAAAAGCATCCCGG - Intergenic
1083188659 11:61033924-61033946 CTGCACAAGCAAAGGCATCTAGG - Intergenic
1084692176 11:70733908-70733930 TGGGCCTAGCAAAGGCACCCAGG - Intronic
1087891621 11:103543170-103543192 ATGGCCATGGAAAGGCAGCCTGG - Intergenic
1094062159 12:26325899-26325921 GTGGCCAAGGAAAGGGCTCAGGG - Intergenic
1095985199 12:47994623-47994645 GTGACCCATGAAAGGCATCCAGG - Intronic
1096096424 12:48938539-48938561 GTGGCAAAGGAAAGGCAAACAGG + Exonic
1097202883 12:57294655-57294677 GAGGCCAAGCAGAGGCAGGCTGG + Intronic
1105761763 13:23521829-23521851 GTGGAAAAGCAAAGGCAGCTTGG - Intergenic
1106135016 13:26967501-26967523 GTGGCCATGAGAAGGCAGCCGGG + Intergenic
1106656499 13:31752479-31752501 GTGGCCAAGAAACACCATCCAGG + Intronic
1113094763 13:106652103-106652125 TTGGCCAAGAAAAGCCATGCTGG - Intergenic
1117776861 14:59191801-59191823 GTGGCCTGGCAAAGGCTTCTGGG - Intronic
1121429055 14:93874033-93874055 ATGGCCAAGCAAAGGCCTGGAGG - Intergenic
1122741050 14:103871871-103871893 GAAGCCAAGCAGAGGCAGCCGGG + Intergenic
1122922521 14:104885874-104885896 GTGCCCCTGCAAAGGCAGCCAGG - Intronic
1123843044 15:24268705-24268727 GTGGCCAGGCCAGGGCATCCTGG + Intergenic
1123858085 15:24434783-24434805 GTGGCCAGGCCAGGGCATCCTGG + Intergenic
1123862713 15:24485241-24485263 GTGGCCAGGCCAGGGCATCCTGG + Intergenic
1129137567 15:73568408-73568430 TTGGCAAAGCAAAAGCATTCTGG + Intronic
1129698853 15:77756008-77756030 GTGGCTCAGCAAAGGCTTGCTGG + Intronic
1132545646 16:531807-531829 GTGGCCAAGCAGAAGCCTCTGGG - Intronic
1133028499 16:2998764-2998786 TTGGCCAGGCCAAGGCCTCCTGG + Intergenic
1133192856 16:4147178-4147200 GGGGCCAATCAGAGGCATCCTGG - Intergenic
1134562165 16:15220059-15220081 GTAGCCTACCAAAGGCAGCCTGG + Intergenic
1134729466 16:16449068-16449090 GAGGCCAAGAAAAGGCCTTCAGG + Intergenic
1134805266 16:17118820-17118842 GTGGCTAAAACAAGGCATCCTGG - Intronic
1134922702 16:18131685-18131707 GTAGCCTACCAAAGGCAGCCTGG + Intergenic
1142279734 16:89141588-89141610 GCGTCCGGGCAAAGGCATCCAGG + Intronic
1144032874 17:11337665-11337687 CTGGCCAAGCAAAGCCATCTTGG - Intronic
1144739839 17:17575683-17575705 GTAGCCAAACACAGGCCTCCCGG - Intronic
1146012580 17:29207611-29207633 CTGGCCAAGCAAAGACATCCAGG + Intergenic
1148517129 17:48230288-48230310 ATGGACAAGAAAAGACATCCTGG - Intronic
1154062103 18:11071781-11071803 GTGTGCAAGCAGAGGCCTCCAGG + Intronic
1161613781 19:5258264-5258286 CTGGCCAAGCTAGGGCTTCCAGG - Intronic
1162378431 19:10318193-10318215 CTGGCCAAGCACAGGCCCCCTGG - Intronic
1164446206 19:28319536-28319558 GTTGCCAAGCAAAGACGACCAGG + Intergenic
1164777069 19:30861286-30861308 GCAGCCTAGGAAAGGCATCCGGG + Intergenic
1164858475 19:31543717-31543739 GGGGCCATGCAAATGCCTCCAGG + Intergenic
932418652 2:71588538-71588560 GTGGCCCAGCAGAAGAATCCTGG + Intronic
932829789 2:74978055-74978077 GTGGCCAAGAAAATGGATGCCGG + Intergenic
933092195 2:78135416-78135438 GTGGCATAGCACATGCATCCAGG - Intergenic
934649488 2:96082845-96082867 CTGGCCAAGCAAAGAGGTCCTGG - Intergenic
937451262 2:122003505-122003527 GAGGGCAGGCAAAGGCAACCAGG + Intergenic
938201031 2:129373258-129373280 CTGGCCAAGCACTGGCCTCCTGG + Intergenic
938754397 2:134366473-134366495 GTGGTCAAAGAAAGGCCTCCAGG - Intronic
939932876 2:148255680-148255702 ATGGCCACGGAAAGGCAGCCTGG - Intronic
948191807 2:236065028-236065050 GTGGCCAGGCAAAGGCTCCATGG + Intronic
948889117 2:240898232-240898254 GTGGACAAGCAAAGGTCCCCGGG + Intergenic
1169140936 20:3227227-3227249 ATGGCCATGCGAAGGCCTCCTGG + Intergenic
1169252613 20:4072046-4072068 GTGGCCAAGGAGAGGAATCTGGG + Intronic
1175002247 20:55641987-55642009 ATGGACAAGCAATGGCATACGGG - Intergenic
1175369796 20:58480608-58480630 GTGGCTAAGCAGAGGCCTCGGGG - Intronic
1176368075 21:6045592-6045614 GGGGCCCAGCCAAGGCAGCCAGG - Intergenic
1179061267 21:37981707-37981729 GGGGCCAAAGAAAGGCATCTTGG + Intronic
1179755444 21:43492950-43492972 GGGGCCCAGCCAAGGCAGCCAGG + Intergenic
1180834212 22:18921822-18921844 GGGGCCGAGCACAGGCAGCCAGG + Intronic
1181065601 22:20304281-20304303 GGGGCCGAGCACAGGCAGCCAGG - Intergenic
1184440527 22:44510034-44510056 GAAGCCAAGAAAAGGCTTCCAGG + Intergenic
1184659691 22:45960153-45960175 GTGGCCAAGGAGAAGCAGCCTGG - Intronic
1203284301 22_KI270734v1_random:147121-147143 GGGGCCGAGCACAGGCAGCCAGG + Intergenic
951034987 3:17922959-17922981 GAAACCAAGCAAAGGCAACCTGG - Intronic
952416350 3:33094271-33094293 GTGGCCAAGGAGAGGTTTCCAGG + Exonic
952608650 3:35181105-35181127 TTGGCCAAGCAAAGGGCTACAGG + Intergenic
952838110 3:37621428-37621450 GTGGCCAGGTACCGGCATCCAGG - Intronic
953529793 3:43730219-43730241 CTGGCCCAGCAAGGCCATCCAGG - Intronic
955192286 3:56772468-56772490 ATTGCCAAGCAAAAGCATTCAGG + Intronic
955557532 3:60154065-60154087 GTGGCCAAGCAAGGCCTCCCTGG + Intronic
955947680 3:64210750-64210772 GTTTCCAAGCAAAGTCACCCAGG - Intronic
961306195 3:125960078-125960100 GTGGCCTGGAAAACGCATCCGGG - Intergenic
962674616 3:137745728-137745750 GTGAACTAGCAAAGGCATCCAGG - Intergenic
963537147 3:146543586-146543608 GTGGCCATGCCAAGACTTCCAGG + Intronic
965385332 3:168038900-168038922 GTGCCCTTGCAAAGGGATCCAGG + Intronic
966410755 3:179643749-179643771 GTGGCAAACCAAAGGCCTGCGGG - Intergenic
967184460 3:186932625-186932647 TTGCCCAAACAAAGGCCTCCTGG - Intronic
967600542 3:191382420-191382442 GTGGCCAAGCACACCCATCTAGG + Intronic
970379563 4:15493215-15493237 GTGGCCAGGTAAGGGCCTCCAGG - Intronic
970723160 4:19011135-19011157 GTGGCTATTTAAAGGCATCCTGG + Intergenic
978205459 4:106075055-106075077 GGGGCAAAGAAAAGGTATCCAGG + Intronic
981578600 4:146230077-146230099 GTGACCAGTCAGAGGCATCCAGG + Intergenic
982215847 4:153082011-153082033 GTGCCCAAGGAGAGGCATCCTGG - Intergenic
985007415 4:185547798-185547820 GAGGCCAAGCAGTGGCAACCAGG + Intergenic
985071507 4:186170569-186170591 ATGGCCAAGCCAAGGCACTCGGG + Intronic
987073698 5:14360758-14360780 GTGGCCAAGCAAAGGCATCCAGG - Intronic
994113071 5:96030462-96030484 TTGACCAAGCATAGGCCTCCAGG - Intergenic
994953502 5:106497290-106497312 GGGGGCAATCAGAGGCATCCAGG - Intergenic
997249612 5:132378309-132378331 GTTTTAAAGCAAAGGCATCCTGG - Intronic
997403138 5:133617923-133617945 GTAGCTAAGCAGAGGGATCCAGG + Intergenic
997581748 5:135021903-135021925 GTGGCCAAGAAAGAGCAACCCGG - Intergenic
999448854 5:151663706-151663728 GTGGCCATGCAAGGTCACCCAGG + Intronic
999577401 5:152994394-152994416 GTGGCCTAGCAAAAGCATTTGGG + Intergenic
1006111305 6:31747299-31747321 GTGTCTAAGCTGAGGCATCCAGG - Intronic
1006134259 6:31886517-31886539 GAGGCCAAGCCAAGGAACCCAGG + Intronic
1006315946 6:33291781-33291803 AGGGCCAAGCAAAGGCTTCAAGG - Exonic
1013046632 6:106492007-106492029 AGGGCCAAGAAAAGGCATTCTGG - Intergenic
1013175904 6:107676243-107676265 CGAGCCATGCAAAGGCATCCAGG - Intergenic
1016760091 6:147727239-147727261 TTGGGCCAGCAAAGGCATTCTGG - Intronic
1018096495 6:160391559-160391581 GCGGCCAAGTCAAGACATCCAGG + Intronic
1018216586 6:161534052-161534074 GAGGCCAGGCAAGGGCTTCCAGG - Intronic
1018865556 6:167744667-167744689 GTGGCTACGCAGAGGCTTCCTGG - Intergenic
1019168626 6:170116052-170116074 GTTACCACGCAAAGGCACCCCGG - Intergenic
1022222752 7:28330080-28330102 GTGGCCAAGCAAGGGCATCTTGG - Intronic
1023829334 7:44029713-44029735 GTGGCCCAGCATGGGCCTCCTGG + Intergenic
1027267777 7:76503687-76503709 GTGGCCAAGCTCAGGCCCCCAGG + Intronic
1027319587 7:77003549-77003571 GTGGCCAAGCTCAGGCCCCCAGG + Intergenic
1029739640 7:102483971-102483993 GTGGCCCAGCATGGGCCTCCTGG + Intronic
1029757641 7:102583150-102583172 GTGGCCCAGCATGGGCCTCCTGG + Intronic
1029775577 7:102682211-102682233 GTGGCCCAGCATGGGCCTCCTGG + Intergenic
1033430117 7:141281578-141281600 GTGGAGAAGCAAATGCACCCTGG + Intronic
1033929549 7:146505855-146505877 GCGGCCATGAAAAGGCAGCCAGG - Intronic
1044908662 8:97032718-97032740 GTTGCTAGACAAAGGCATCCTGG - Intronic
1054763985 9:69027330-69027352 GTGGCCAGGCACACACATCCAGG - Intergenic
1055409325 9:76011254-76011276 GTGGCCAATCAAATGCATTATGG + Intronic
1055984269 9:82040165-82040187 GGGGGCAAGCAAAGGGCTCCTGG + Intergenic
1057863880 9:98663976-98663998 ATAGCTAAGAAAAGGCATCCCGG + Intronic
1059346042 9:113628630-113628652 GTGGCCAGGAAAAGCCAGCCAGG - Intergenic
1059761508 9:117342162-117342184 GTCCCCGAACAAAGGCATCCTGG + Intronic
1060723760 9:125994526-125994548 GTGGCCAAATGCAGGCATCCAGG - Intergenic
1060983008 9:127804187-127804209 GTGGCCAAGCCAGGGCAACAAGG - Intronic
1186261800 X:7788007-7788029 GAGGCAAAGCAAAAGCACCCGGG + Intergenic
1189242750 X:39538039-39538061 ATGTGCAAGCAAAGGCAGCCAGG + Intergenic
1196635707 X:118000198-118000220 TTGGCCAAACAAATGCAGCCGGG + Intronic
1196790421 X:119459413-119459435 GTGGCCAAAGAAAGGCCTCAAGG + Intergenic
1199529706 X:148832526-148832548 GTTGCTAAGCCAAGGCATGCAGG + Intronic
1202170499 Y:22038641-22038663 GAAGTCAAGCAAAGGCATCATGG + Intergenic
1202220865 Y:22547732-22547754 GAAGTCAAGCAAAGGCATCATGG - Intergenic
1202322248 Y:23647931-23647953 GAAGTCAAGCAAAGGCATCATGG + Intergenic
1202548520 Y:26022125-26022147 GAAGTCAAGCAAAGGCATCATGG - Intergenic