ID: 987074602

View in Genome Browser
Species Human (GRCh38)
Location 5:14369228-14369250
Sequence AAGGAGCCATGGGCTCCACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 1, 2: 1, 3: 19, 4: 174}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987074602 Original CRISPR AAGGAGCCATGGGCTCCACC TGG (reversed) Intronic
900423180 1:2564501-2564523 TAGGGGCCCAGGGCTCCACCTGG - Intronic
900541341 1:3204534-3204556 ACGGAGCCACGGGCTCCCCTGGG - Intronic
909635145 1:77809230-77809252 AAGGAGCCCTGTGGACCACCTGG + Intronic
914521280 1:148419016-148419038 AAGGAGGCATGGTCTTCACATGG + Intergenic
914646692 1:149659507-149659529 AAGGAGGCATGGTCTTCACATGG + Intergenic
919655548 1:200193684-200193706 AGGGAGCCAGGCACTCCACCAGG + Intergenic
919927052 1:202197091-202197113 CAGGAGCTATGGGCTCCAGAAGG + Intronic
920030687 1:203035743-203035765 AAGGAGCCAGGTGCCCCACGTGG + Intronic
920209882 1:204320381-204320403 AAGGAGCCATGCCCTCCATCTGG + Intronic
923158945 1:231301211-231301233 AAGGTGCCATGGGCAAGACCAGG - Intergenic
924633379 1:245763054-245763076 AGAGAGCCCTGGGCTCCTCCGGG + Intronic
924744855 1:246822395-246822417 GAGGAGCCCTGAGCACCACCGGG - Intergenic
1062869305 10:885712-885734 CAGAAGTCATGGGCTCCACTGGG + Exonic
1063231285 10:4067822-4067844 AAGGAGCAATGTGCTCTGCCAGG - Intergenic
1063611957 10:7570240-7570262 AGGAAGCCATGGGCTACCCCAGG + Intronic
1064742001 10:18443410-18443432 AAGGAGGCCTGGGCTCCTGCTGG - Intronic
1065179057 10:23106752-23106774 GAGAAGCCATGGCCTCCACTAGG - Intronic
1067379664 10:45761307-45761329 AAGGCGACATGGCCTCCATCGGG - Intronic
1067462841 10:46470507-46470529 AAGGAGCCATCAGCTTCCCCTGG + Intergenic
1067624353 10:47914130-47914152 AAGGAGCCATCAGCTTCCCCTGG - Intergenic
1069559992 10:69422576-69422598 AAGGAACCCTTGGCTCCCCCAGG - Intergenic
1069921611 10:71819045-71819067 AAGGATCCATCACCTCCACCAGG + Exonic
1070790565 10:79186924-79186946 AAGGGGGCATGGCCTCCAGCAGG - Intronic
1079614174 11:22470270-22470292 AAGGAGCCATGCACTTCACATGG + Intergenic
1079759654 11:24312538-24312560 AGGCAGCCATGGGCTCTATCAGG + Intergenic
1080597123 11:33782955-33782977 GAGGAGCCATGGGCTCCCTGAGG + Intergenic
1080793615 11:35542964-35542986 CAGGACCCATCAGCTCCACCAGG + Intergenic
1081391306 11:42532445-42532467 AAGGACCCATCAACTCCACCTGG - Intergenic
1084403845 11:68959970-68959992 CAGGGGCCATGGGATCCATCGGG - Intergenic
1085279484 11:75320602-75320624 AAGAGGCCATGGGCTCCACATGG + Intronic
1085356405 11:75842128-75842150 AAGGTGACATGGCTTCCACCTGG - Intronic
1085533572 11:77205433-77205455 GAGGAGGCGTGGGCTCCAGCAGG - Intronic
1090333255 11:125947178-125947200 AGGGAGCCCTGGGATCCTCCTGG + Intergenic
1091603727 12:1933602-1933624 AAGGAGCCAGGGCCTGCCCCTGG - Intergenic
1096773372 12:53950221-53950243 TGGGAGCAATGGGCCCCACCAGG - Intergenic
1099935845 12:89124432-89124454 AAAGAGCCATTGGGTCCTCCTGG - Intergenic
1101952953 12:109190446-109190468 AGGCAGCCATGGGGCCCACCAGG + Intronic
1106061761 13:26299974-26299996 AATGAGCCATGGGCTGAACTTGG + Intronic
1106143233 13:27028520-27028542 CACGAGCCATGGGCTTCACCTGG - Intergenic
1111414412 13:87920130-87920152 CAGGAGTGATGGGCTCCAGCAGG - Intergenic
1113894355 13:113754376-113754398 AAGGTGCCACAGACTCCACCCGG + Intergenic
1114494033 14:23120341-23120363 AGGGAGCCATGGGCTTCTCCTGG - Intergenic
1117290453 14:54327025-54327047 GCCGAGCCATGGGCTCCTCCGGG + Intergenic
1118838504 14:69493914-69493936 AAGGAGGGATGGGCTTCACACGG + Intronic
1121090834 14:91181239-91181261 AAGGATGCAAAGGCTCCACCTGG + Exonic
1124058043 15:26260703-26260725 GAAGAGCCTTGGGCTCCCCCTGG + Intergenic
1126112864 15:45185931-45185953 ACCAAGCCATGGGCTCCTCCAGG - Intronic
1127402713 15:58606140-58606162 AAGGAGCTCTGGGCCCCACATGG - Intronic
1128264434 15:66254270-66254292 ATGGAGCCAGGGGCACCCCCAGG + Intergenic
1129783142 15:78287955-78287977 ATGGAGCCATGGGCTGTAGCTGG - Intronic
1131361375 15:91793702-91793724 AAGGAGCCATGGCCTTGACTTGG + Intergenic
1132246549 15:100300568-100300590 AAGGAGCCTTGGGCTCCACCAGG + Intronic
1133989691 16:10694911-10694933 AAGGAGCCAAAGGCATCACCAGG + Exonic
1136040529 16:27575352-27575374 AAGGAGCCATAGGTTACTCCAGG + Intronic
1136502295 16:30678063-30678085 AAAGAGCCTTGGACTCCACTGGG + Intergenic
1137629492 16:49932175-49932197 AAGGAGACCTGGGCTCTGCCAGG - Intergenic
1138657834 16:58501037-58501059 GAGGTGCCCTGGGCTCCACCTGG - Intronic
1139110688 16:63886995-63887017 GAGAAGCCAGTGGCTCCACCAGG - Intergenic
1141269064 16:82522505-82522527 AAGGAGGCATGGCCTGAACCTGG - Intergenic
1141586252 16:85035360-85035382 AGGAAGCCCTGGTCTCCACCTGG + Intronic
1141708186 16:85681304-85681326 AAAGAGCCAAGGGCTTCACCGGG + Intronic
1141716557 16:85730285-85730307 AATGAGACATGGGCTCCTCTAGG - Intronic
1141894103 16:86947467-86947489 GAGGAGCTCTGGGGTCCACCAGG + Intergenic
1142191809 16:88721561-88721583 AAAGGGCCATGAGCTGCACCAGG + Exonic
1142560089 17:804649-804671 AAGGAGCCAAGGCAGCCACCGGG + Intronic
1144075643 17:11716934-11716956 TAGCAGGCATGGGATCCACCTGG + Intronic
1144734174 17:17545615-17545637 AATGAGTCATGGGCTGGACCCGG - Intronic
1146928514 17:36761798-36761820 AAGGGGCCCTGGGCCGCACCCGG - Intergenic
1147635550 17:41961785-41961807 AAAGGGCCATGGGCTCCTCCAGG - Intronic
1148356269 17:46978002-46978024 AAGGATCCTGGGGCTCCACGCGG - Intronic
1151719660 17:75847891-75847913 GAGTAGCCATAGGCTCCACTGGG + Exonic
1152375819 17:79918453-79918475 GATGAGCCATGGCCTCCATCAGG + Intergenic
1152611597 17:81317565-81317587 GAGGAGCCATGGGATCTCCCAGG - Intronic
1152632749 17:81417872-81417894 ATGCAGCCATGGGCTCAGCCCGG - Intronic
1156883563 18:42108460-42108482 AAGTAGCCATGGGCTGCTGCAGG + Intergenic
1158325857 18:56313567-56313589 TAGGACCCAAGGGCTCAACCAGG + Intergenic
1159545913 18:69839354-69839376 AAGGAGTCATGGGATAGACCAGG - Intronic
1159870363 18:73754506-73754528 AAGGAGCAATAGGCTACACCAGG + Intergenic
1162555702 19:11384221-11384243 CAGGAGCCCTGGGCTCCCCGTGG - Exonic
1163692503 19:18745291-18745313 GAGCAGCCCTGGGCTCCACAAGG + Intronic
1163775332 19:19213979-19214001 TAGGTCCCATGTGCTCCACCCGG + Intronic
1164439382 19:28261039-28261061 AAGGAGTCAAGGGCTCCTACAGG - Intergenic
1165134618 19:33660000-33660022 ACTGGGCCCTGGGCTCCACCAGG + Intronic
1166051381 19:40262734-40262756 AAGGTGGCATGTGCTCCACAGGG + Intronic
1166518784 19:43465557-43465579 ACGGAGCCATGGACCCCGCCAGG - Exonic
926322437 2:11758574-11758596 ACAGGGTCATGGGCTCCACCTGG - Intronic
927093138 2:19727770-19727792 CAGGAGCCCTGGGTTCTACCCGG - Intergenic
927498268 2:23564786-23564808 AAGGAGCCGTGAGCTCCCCGAGG - Intronic
927587063 2:24317559-24317581 AAGGAGACATGGGCAGAACCTGG + Intronic
930167122 2:48214030-48214052 AGGGAAATATGGGCTCCACCTGG + Intergenic
931426778 2:62178660-62178682 AAGGAGCCATTGTCCCCAGCAGG - Intergenic
934780798 2:96968486-96968508 GAGGACCCATGGGCCCAACCAGG - Intronic
935146942 2:100402077-100402099 CAGCAGCCTTGGGCTCCGCCAGG + Intronic
935613107 2:105046643-105046665 AAGGAGCCATACGCTCCAGGAGG + Intronic
935636420 2:105252537-105252559 AAGCAGCCAGGGGCCCCATCTGG - Intergenic
936339232 2:111616764-111616786 AGGGAGCCATGGACTTCACCTGG - Intergenic
937155462 2:119715780-119715802 CAGGAGACATGGGGTGCACCAGG - Intergenic
937907535 2:127059479-127059501 CAGGCTCCATGGGGTCCACCAGG + Intronic
943383588 2:187177353-187177375 AAGGAGCCAGGGACACCACGCGG - Intergenic
945155925 2:206837457-206837479 AAGGAGCCATGTGCTATACTAGG + Intergenic
947542855 2:230990690-230990712 GAGGCGCCAGGGGCTCCTCCTGG + Intergenic
948901501 2:240958837-240958859 AAGGGGCCATGGGCTGAGCCTGG + Intronic
948906652 2:240982849-240982871 AAGGAGACACAGGGTCCACCTGG - Intronic
1168809464 20:694770-694792 AAGAAGCCATGGGCTCGTCAAGG + Intergenic
1168940612 20:1708066-1708088 ACGGAGCCATGGCCTTCCCCTGG - Intergenic
1170876213 20:20252765-20252787 AAGGAGACAGGGTCTCCACCTGG + Intronic
1172310659 20:33915857-33915879 CAGGAGGCAAGGGCTCCCCCTGG - Intergenic
1176100549 20:63362436-63362458 GAGGAGCCATGAGCTCAACCTGG - Intronic
1176389924 21:6158203-6158225 AGGGAGCCCTGGGCCCCACCCGG - Intergenic
1177112860 21:17049491-17049513 CAGGAGCCATGGGCTGTAGCTGG - Intergenic
1179539024 21:42072160-42072182 CAGGAGCCAGAGGCTGCACCAGG + Intronic
1179733542 21:43380037-43380059 AGGGAGCCCTGGGCCCCACCCGG + Intergenic
1183047217 22:35229712-35229734 AAGAAGCTGTGGGCTCCCCCTGG + Intergenic
1184172095 22:42765773-42765795 AAGGATCCCTGAGCTCCACCTGG - Intergenic
1184349754 22:43935926-43935948 AGGCAGCCACAGGCTCCACCAGG + Intronic
1185132915 22:49050369-49050391 AGGCTGCCATGGTCTCCACCTGG + Intergenic
950741573 3:15056497-15056519 AAGGACCCATGGGGTTAACCTGG - Intronic
951641605 3:24842904-24842926 CAGGAGCCATGGGCTCAGCCCGG - Intergenic
952820659 3:37483085-37483107 AAGGAGCGATGGGCTCAGCAGGG + Intronic
954314360 3:49793137-49793159 TAGGGGACATGGGCACCACCAGG - Intronic
954397008 3:50298326-50298348 AGGGGGCCATGGGCTCCAGGTGG - Intronic
954791941 3:53139838-53139860 AAGGAGCCAGGGGCACCCCCAGG + Intergenic
954793321 3:53148472-53148494 AAGATCCCATGGTCTCCACCAGG + Intergenic
957690586 3:83561322-83561344 AAGGAGCCTTAGACTCCACGGGG + Intergenic
959615794 3:108345804-108345826 AAGGGGCCATAGGCACAACCAGG + Intronic
961388191 3:126536280-126536302 ACAGAGCCCTGGGCTCCAGCTGG + Exonic
961633397 3:128317880-128317902 AAGGAACCATGGTTACCACCTGG - Intronic
961813003 3:129532494-129532516 GAGGAGCCATGGTCTGGACCCGG + Intronic
964167515 3:153726266-153726288 AAGGAACCTTGGGGTCCCCCAGG - Intergenic
964170929 3:153768609-153768631 AGGTAGCCATGGGGCCCACCCGG - Intergenic
965206155 3:165720817-165720839 TCTGAGCCATGGACTCCACCTGG + Intergenic
965869519 3:173249405-173249427 AAGGAGGCATTGGCAGCACCTGG + Intergenic
968786151 4:2623672-2623694 AAGGAGCCTGGGGCTCACCCTGG - Intronic
969212815 4:5700736-5700758 AAGGTGCTATCGGCTGCACCTGG - Intronic
969705694 4:8789959-8789981 AGGAAGACATGGGCTCCAGCTGG - Intergenic
970002236 4:11375533-11375555 ATGAAACTATGGGCTCCACCAGG + Intergenic
970561014 4:17282386-17282408 CAGGAGCCAGAGGGTCCACCGGG - Intergenic
975001146 4:69224299-69224321 GAGGGGCCATGGTCTCAACCAGG + Intergenic
979136672 4:117118772-117118794 CAGGAGCCATGGGCTGGAGCAGG - Intergenic
979692990 4:123580396-123580418 AAGGAGCTAAGGTCTCCCCCAGG - Intergenic
980974443 4:139597566-139597588 ACGGACCCATGGTCTCAACCAGG - Intronic
985547753 5:518641-518663 CAGGAGCCAGGGGCTGCACTGGG - Intronic
985823079 5:2173797-2173819 TAGGAGCCCTGGGCCCCAGCAGG - Intergenic
987074602 5:14369228-14369250 AAGGAGCCATGGGCTCCACCTGG - Intronic
990536225 5:56725387-56725409 AAACAGCTAAGGGCTCCACCCGG + Intergenic
990988074 5:61659427-61659449 AAGGAGCCAGGTGCTCTTCCCGG - Intronic
994350290 5:98737692-98737714 GAGCTGCCATGGGCTCCACCCGG - Intergenic
997212643 5:132086517-132086539 TAGGAGCCAGGGCCTCCATCAGG - Intergenic
999247846 5:150164860-150164882 AGGTAGCCAAGGGCTCCGCCCGG + Intergenic
999260092 5:150232933-150232955 GAGGAGCCAGGCTCTCCACCTGG - Intronic
1003167005 6:3688444-3688466 CTGGAGCCATGGGCCACACCAGG - Intergenic
1003279213 6:4677327-4677349 AAGGCGACATGGTTTCCACCTGG - Intergenic
1005015451 6:21371040-21371062 ATGGAGGCTTGGACTCCACCTGG + Intergenic
1007687941 6:43678305-43678327 AATGATGCATGGGCTCCACCAGG - Intronic
1008539013 6:52530272-52530294 AGGGTGGCAGGGGCTCCACCAGG + Intronic
1009939596 6:70274738-70274760 ATGGAGCCAGGGGATCCATCAGG + Exonic
1011801492 6:91021057-91021079 AAGGAGAAATGGGATCCACATGG - Intergenic
1013017529 6:106174304-106174326 TAGGAGCCATGGGCTAGACCAGG + Intergenic
1013793082 6:113857902-113857924 AATGAGCCTTGGGAGCCACCAGG - Intronic
1014330850 6:120061593-120061615 ATAGAACCATGAGCTCCACCGGG + Intergenic
1018203174 6:161413622-161413644 ACAGAGGCATGGGCTGCACCGGG + Intronic
1018379617 6:163246357-163246379 AAGGAGCCATGCGCAGAACCAGG - Intronic
1018919452 6:168161251-168161273 ACTGAGCCATGGGCTTCGCCTGG - Intergenic
1019022306 6:168929606-168929628 AAAGAGTCATTGGCTCCACATGG + Intergenic
1019522988 7:1468916-1468938 CTGGAGCCATGGGCTGCCCCAGG - Intergenic
1019929617 7:4214995-4215017 AGGCAGCCATGAGGTCCACCTGG - Intronic
1019972176 7:4549983-4550005 AAGCTGCCATGGCCTCCAGCTGG - Intergenic
1022498663 7:30868970-30868992 AAGGAGAGATGGGCTTGACCAGG - Intronic
1024220677 7:47284193-47284215 AAGGTGCCTTGGGCTCCACCTGG - Intronic
1027054253 7:75039173-75039195 AAGGAGGCCTGGCCTTCACCTGG - Intronic
1028484769 7:91345687-91345709 AAGGAGAAATGGCCTCCTCCGGG + Intergenic
1032229574 7:130063012-130063034 AAGTGTCCATAGGCTCCACCAGG + Intergenic
1034265896 7:149780511-149780533 AGGGATCCAAGGGCACCACCTGG - Intergenic
1035933023 8:3805284-3805306 AAGGAGCCACAGATTCCACCAGG + Intronic
1035967783 8:4213670-4213692 AAGCAGCCATGGGCCCTCCCTGG + Intronic
1038440624 8:27568884-27568906 AAGGAGCCATGGGTTCCTGGGGG - Intergenic
1041101568 8:54400970-54400992 AAGGACCCCTGGGCTCCTGCAGG - Intergenic
1041151930 8:54944172-54944194 CAGGAGCCATGGGCTGGAGCAGG - Intergenic
1047152745 8:122283172-122283194 TAGGAGCCATAAGCTCCACGGGG - Intergenic
1048759625 8:137779277-137779299 AAGGAGCCATCAGCACCTCCTGG + Intergenic
1049381054 8:142315967-142315989 AAGGAGCCATTCGCTTCACGAGG + Intronic
1052863855 9:33453243-33453265 AAGAAGTCATGGGCTCCCACGGG - Intergenic
1053243379 9:36515261-36515283 AAGGAGCCATGGGCTTGGACTGG + Intergenic
1057077262 9:92144546-92144568 CAGGAGCTATGGGCTCCAGAAGG + Intergenic
1059507405 9:114812463-114812485 AAGACTCCCTGGGCTCCACCCGG - Intergenic
1061846375 9:133390794-133390816 AAGGTGGCAGGGGCTCCCCCAGG + Exonic
1062168413 9:135120578-135120600 TGAGAGCCATGGGCTGCACCCGG + Exonic
1062178191 9:135175949-135175971 AAGAAGCCATGGTTTCCACTGGG - Intergenic
1062723950 9:138060711-138060733 AAGGAGCCTGGTGCTCCAGCAGG - Intronic
1189390100 X:40569419-40569441 AAGGTGCTATGGCTTCCACCTGG + Intergenic
1190402116 X:50047664-50047686 AAGGAGCTAAGGGCTCCTCTTGG + Intronic
1195469873 X:105219557-105219579 GGGGAGCCATGGCCTCCACAGGG + Exonic
1197603393 X:128557243-128557265 AATGAGCCATTGGCTCTTCCTGG - Intergenic
1197766267 X:130061019-130061041 AAGCAGCCCTGGGCTCCTCATGG + Intergenic
1200106366 X:153715486-153715508 AAGGAGCCATGGGCTAGCCATGG - Intronic
1200275088 X:154724458-154724480 ATGGAGACATGGGCTCCAGAAGG - Intronic