ID: 987077082

View in Genome Browser
Species Human (GRCh38)
Location 5:14393544-14393566
Sequence CTGGTAAGAAGCATAATCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 159}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987077082_987077084 5 Left 987077082 5:14393544-14393566 CCTTTGATTATGCTTCTTACCAG 0: 1
1: 0
2: 1
3: 7
4: 159
Right 987077084 5:14393572-14393594 AGCATTATTGAACATCTGTATGG 0: 1
1: 0
2: 0
3: 13
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987077082 Original CRISPR CTGGTAAGAAGCATAATCAA AGG (reversed) Intronic
901884265 1:12211721-12211743 CTGGTAGGCTGCATAACCAATGG - Intergenic
902586431 1:17441500-17441522 CTGGCAAAAAGCATTATAAAGGG - Intergenic
905398448 1:37683788-37683810 CTGGTAGGAAACATGAACAAAGG + Intronic
906959196 1:50405419-50405441 CTTGTAAGAATTAGAATCAAGGG + Intergenic
907659399 1:56378176-56378198 CTGGTGAGATGCAAAATAAAAGG + Intergenic
909285042 1:73805640-73805662 GTCTTAAGAAGCATAAGCAAAGG + Intergenic
910465076 1:87490386-87490408 TAGGCAAGAAACATAATCAATGG - Intergenic
910585824 1:88878514-88878536 CTGGGGAAAAGCATTATCAAAGG + Intronic
912936978 1:114012242-114012264 ATGGTAAGAAGCAGAGTCCAGGG - Intergenic
915945152 1:160144318-160144340 CTGTTAAGAGTCATAATAAAGGG - Intergenic
918384067 1:183987241-183987263 GTGGGAAGAAGAATAAACAAGGG - Intronic
918743479 1:188167552-188167574 CTTGTATGAAGCACAATCACAGG - Intergenic
919045594 1:192447609-192447631 TTGGGAAGATGCATAATGAATGG + Intergenic
919219113 1:194602357-194602379 CCGGTAAGATGCATGATTAATGG - Intergenic
924266720 1:242290185-242290207 AGGGTAAGAAGCTTAATCAGAGG + Intronic
924543743 1:245005968-245005990 CTGGGAAAAAGCATTATCACTGG + Intronic
1064940790 10:20733289-20733311 TTGGTATGAATCATAAGCAATGG - Intergenic
1066718114 10:38308372-38308394 AGGGTAAGAAGCTTAATCAGAGG - Intergenic
1067916239 10:50402115-50402137 CTGGTCAAAAGCCTAATTAATGG + Intronic
1068303045 10:55170581-55170603 CTGGTAGAAAGCATAATTGATGG + Intronic
1068638385 10:59373725-59373747 CTAGAAAGAAGCATAATATAAGG + Intergenic
1069109236 10:64424638-64424660 CTGGCCAGAAGCTTAATCAATGG + Intergenic
1071954293 10:90741058-90741080 CTGGTAAGAAGCAATGTCAATGG + Exonic
1072456753 10:95583006-95583028 CTAGAAAAAAGCATAATTAATGG - Intergenic
1073572628 10:104593335-104593357 CTGAACAGAAGGATAATCAATGG - Intergenic
1073600461 10:104841428-104841450 TTGGCAAGAAACATCATCAATGG - Intronic
1076145165 10:128113002-128113024 CTGGTGTGAAGGAAAATCAATGG - Intronic
1077842183 11:5986872-5986894 TTGCTAAGGAGCATTATCAATGG + Exonic
1078798114 11:14614271-14614293 CTGGTAAGAAGTGTCATCAGTGG + Intronic
1085117691 11:73944800-73944822 CTGGGAAGCAGCATAGTAAAAGG - Intergenic
1092425818 12:8374897-8374919 CTGCTAAGAATAATAATGAATGG + Intergenic
1092895297 12:13004556-13004578 GTGGTAAGAAGCAATGTCAATGG - Intergenic
1096550751 12:52370145-52370167 CTGGGTAGAACCATAAGCAAAGG - Intergenic
1098485254 12:71013839-71013861 CTGCTCAGAAGTATGATCAAAGG + Intergenic
1098944100 12:76571530-76571552 CAGGTAAGATGCATAGGCAATGG - Intergenic
1098973862 12:76881646-76881668 CTTGTAATAGGCAGAATCAAAGG + Intergenic
1100345431 12:93725218-93725240 CTGGTAAAAAGGAAAAGCAAAGG - Intronic
1100769709 12:97908430-97908452 CTGGCAAGAACCATTTTCAATGG - Intergenic
1104655692 12:130572381-130572403 CCGGGAAGAAGGAAAATCAATGG - Intronic
1107808445 13:44176408-44176430 CTGGCAAGATGTATAAACAAAGG + Intergenic
1108467523 13:50731686-50731708 TTGCTAAGAAGTATAAACAAAGG + Intronic
1109773879 13:67014452-67014474 CAGGTAAGTAGCATAATAGAGGG - Intronic
1109846549 13:67999830-67999852 ATGGGAAAAATCATAATCAATGG + Intergenic
1110143117 13:72155540-72155562 CTGGTATTAAGGATAAACAAAGG - Intergenic
1111915548 13:94356656-94356678 CTGGCAAGTAACATAAGCAAAGG + Intronic
1113692495 13:112321396-112321418 CCGGGAAGAAGCTTATTCAATGG + Intergenic
1113984561 13:114303483-114303505 CTGGTAAGAAGCAGAATTGTCGG + Intronic
1115910235 14:38248303-38248325 CTGCTAAGAATCAAAAGCAAGGG + Intergenic
1117618599 14:57560392-57560414 CAGGTATGAAGAATAATCAAGGG - Intergenic
1121054123 14:90839076-90839098 CTGGGCAGAAGCAAAATCAGTGG - Intergenic
1121067502 14:90982674-90982696 CTGTTAAGAAATATAAGCAAGGG + Intronic
1122073861 14:99223111-99223133 CTGGTAAGAAGCACTATCAATGG + Intronic
1127113296 15:55697959-55697981 GTGGTAAGGAGAAGAATCAATGG - Intronic
1128405984 15:67339575-67339597 GTTGTAAGTAGCCTAATCAAAGG + Intronic
1140127400 16:72129715-72129737 CCAGTAAGAAGCATTTTCAATGG - Intronic
1141262913 16:82470003-82470025 CTGGGTAGAAGCAGAATCACAGG + Intergenic
1144428426 17:15168003-15168025 CTGGAAAGAAATATAATAAAAGG + Intergenic
1148418980 17:47530690-47530712 CTGTTAAGTAGCAAATTCAAAGG - Intronic
1149939257 17:60845468-60845490 CTGTTAAGGATCATAAGCAATGG - Intronic
1149982625 17:61323424-61323446 CTGGTAAGCTGTATAATCACAGG + Intronic
1150160530 17:62894159-62894181 CTGATATGAAGAATAGTCAAAGG + Intergenic
1150979957 17:70130123-70130145 ATGGGATGAAGTATAATCAAAGG - Intronic
1153911985 18:9712429-9712451 CTGGTAAGAAGGAAACTCATGGG - Intronic
1155841529 18:30650499-30650521 GAGGAAAGAAGCAGAATCAATGG + Intergenic
1158368903 18:56774261-56774283 CTGTTGAGAAGCAGAATCTAGGG + Intronic
1159351399 18:67279538-67279560 CTGGTTAGGAGCTAAATCAAGGG + Intergenic
1167438225 19:49492220-49492242 CTGGGAAGATGCACAACCAAGGG + Exonic
925900694 2:8507451-8507473 CTGATGAGAAGCCTCATCAATGG - Intergenic
926957414 2:18316740-18316762 CTAGTGAGAAGAATATTCAAAGG - Intronic
927280745 2:21304128-21304150 CTAGTTAGAAGCAAAATAAATGG + Intergenic
931740739 2:65240505-65240527 ATGGTAAGATACATAATCCAAGG - Intronic
934453200 2:94067292-94067314 CTGGACAGAAGCATTCTCAAAGG + Intergenic
939603714 2:144226245-144226267 CATGTTAGAAGCATTATCAAGGG + Intronic
942398491 2:175576897-175576919 CTGGTAAGAATAATAAGAAAGGG - Intergenic
942739899 2:179164203-179164225 CTGGAAAGAATCAGAATAAATGG + Intronic
945448942 2:209971545-209971567 CTGGAAAGCTCCATAATCAATGG + Intronic
947261313 2:228226066-228226088 GTGGTAAAAAGCATAAGCTATGG - Intergenic
1170130637 20:13015326-13015348 ATGGCAAGAAGCATCATAAAGGG + Intronic
1170135182 20:13065351-13065373 AAGGTAAAAAGCATAATAAAAGG - Intronic
1170207494 20:13814231-13814253 ATGGGAAGAAGCATAGTCAGGGG + Intronic
1175028389 20:55927758-55927780 CTAGGAAGAAGCATAAGCTAAGG + Intergenic
1177757328 21:25362835-25362857 CTGGGAAGATGCACAACCAAGGG + Intergenic
1178551739 21:33546059-33546081 ATGGTAAGAAGCATTATTAGTGG + Intronic
1183179632 22:36251196-36251218 CTGCTTAGAAGCAAAAACAAAGG - Intergenic
1184441080 22:44516366-44516388 CTGGTAAGAAAGAGAAACAAAGG - Intergenic
949835345 3:8263413-8263435 CTGCTAATAACCATGATCAATGG + Intergenic
950554931 3:13689622-13689644 CTGGCAGGAAGTATAATTAATGG + Intergenic
950957342 3:17068500-17068522 ATTGTATGGAGCATAATCAAAGG + Intronic
951027021 3:17841166-17841188 CTGCTAAAAAGGCTAATCAATGG - Intronic
951713942 3:25618417-25618439 CTGGAAAGAAGCACAAGAAAAGG - Exonic
954961296 3:54567399-54567421 GTGGAAAGAAGGAAAATCAAGGG - Intronic
955937107 3:64112525-64112547 ATGGTATGAAGGATAATAAAGGG + Intronic
956321690 3:68004700-68004722 CAGGTAAGAAGCATCTTTAAGGG + Exonic
956697180 3:71928616-71928638 CTTGTAAGAACCATGATGAATGG - Intergenic
958074755 3:88661885-88661907 ATGGTAGAAAGCCTAATCAACGG + Intergenic
958599791 3:96280962-96280984 CTGGTAAGAATAATAGCCAATGG - Intergenic
960032046 3:113063899-113063921 CTGGTAAGGAGTATAACCAGTGG + Intergenic
960183671 3:114612803-114612825 AAGATAAGAAGCATAATGAAAGG + Intronic
962232806 3:133680641-133680663 AGGGTAAGAAGCACAACCAAGGG - Intergenic
963001664 3:140687415-140687437 CTGGTAAAAACCAATATCAAGGG + Intronic
963587361 3:147209264-147209286 CAGTTAAGATGAATAATCAAAGG - Intergenic
964709436 3:159656124-159656146 CTGGTAAGAAGAATCTTCTATGG + Intronic
965296141 3:166949116-166949138 CTGGTAATAAGCATAGTAACTGG - Intergenic
965642155 3:170840479-170840501 CTGGATAGAAGCACAATCAGAGG + Intronic
970244376 4:14043855-14043877 CTAGTAAAAAGCATTATCAGGGG - Intergenic
972810273 4:42576966-42576988 TTGGGAAGAACCAGAATCAAAGG + Intronic
973830715 4:54756189-54756211 CTGGCAAGAAGCATAGTAATAGG + Intergenic
974841204 4:67301166-67301188 CTGCTCAGACGTATAATCAAAGG + Intergenic
976441549 4:85081742-85081764 CTACTAAGAAGCATATTGAATGG - Intergenic
977790633 4:101097273-101097295 CTGGTGAGAATAATAATAAAAGG + Intronic
982418748 4:155168481-155168503 ATGACAAGAAGCATTATCAAAGG + Intergenic
982672768 4:158341763-158341785 CTGGTATAAGGAATAATCAATGG - Intronic
983920772 4:173342060-173342082 GAGGAAAAAAGCATAATCAAGGG + Intergenic
987077082 5:14393544-14393566 CTGGTAAGAAGCATAATCAAAGG - Intronic
987856040 5:23422197-23422219 TTAGGAAGAAGGATAATCAAGGG + Intergenic
988013482 5:25521336-25521358 CTGGTCATAAGCATAAACTAAGG - Intergenic
988034572 5:25809530-25809552 CTGGGTAGAAGCATAGTCAAAGG - Intergenic
988084836 5:26461781-26461803 CATGCAAGAAGCATAAGCAAAGG + Intergenic
989230196 5:39076022-39076044 GTGGTAAGAAGAAAAATAAAAGG + Intergenic
989295924 5:39826572-39826594 CTGGTAAGCAGCAAAAAAAAAGG - Intergenic
991207983 5:64071772-64071794 CATATGAGAAGCATAATCAATGG + Intergenic
991456842 5:66812925-66812947 CTGATAAGAAGCAGCATCACTGG + Intronic
992060583 5:73041977-73041999 CAGGTAAGAACAATAAGCAAAGG - Intronic
992185281 5:74238596-74238618 ATGGTAAAAGGCAGAATCAAAGG + Intergenic
994148814 5:96424303-96424325 CTGGTATGAAGCTGAATCACAGG + Intronic
994610119 5:102025576-102025598 CAGGTAGAAAGCATAATGAATGG + Intergenic
998383000 5:141739170-141739192 GTGGTAAGCAGCACAATCACAGG + Intergenic
998682716 5:144487955-144487977 ATGGTAATAAGAATAAGCAAGGG - Intergenic
998751225 5:145323566-145323588 CAGGTAATAAGCATAGTAAATGG + Intergenic
1003129146 6:3380367-3380389 TTGGTAAGAAGAATATTCCAGGG + Intronic
1004972882 6:20931428-20931450 CTGGTAAGAGGCAGAGTCAGGGG + Intronic
1006315082 6:33286504-33286526 CTGATAAGAGGTAAAATCAAAGG - Intronic
1007141021 6:39574980-39575002 CTTTTATGAAGCAAAATCAAGGG - Intronic
1007198787 6:40087519-40087541 CTAGTAATAAACCTAATCAAAGG - Intergenic
1011385331 6:86791003-86791025 CTGATGAGAAGAATAATCCAAGG - Intergenic
1012593937 6:101018770-101018792 CAGGTGAGAAGCAATATCAAAGG + Intergenic
1012879485 6:104768821-104768843 CTGGTGAGATGCACAATGAAGGG + Intronic
1013646979 6:112154283-112154305 ATGGTAAGAAGCATTTCCAAAGG - Intronic
1015552423 6:134426058-134426080 CCTGAAAGAAGCAGAATCAATGG - Intergenic
1017464146 6:154678930-154678952 CTGGTAAGTAGCATGCTCCAGGG + Intergenic
1017740363 6:157400822-157400844 CTGGTAAGAGGCAGAGCCAAAGG - Intronic
1020816054 7:12907613-12907635 CAGGTAAGTAGCACAAACAAAGG + Intergenic
1021330730 7:19335928-19335950 CTTGTAAGACGGATATTCAAAGG - Intergenic
1025934712 7:66026258-66026280 GTGGTTAAAAGCATAAGCAAAGG + Intergenic
1026300835 7:69096671-69096693 CTGGGAAGAAACATAAGCACAGG + Intergenic
1027504641 7:79000750-79000772 CTAAAAAGAAGCATTATCAAGGG - Intronic
1027942625 7:84704163-84704185 CAGGTAATAAGTATCATCAATGG + Intergenic
1029901569 7:104046622-104046644 CTTTTAAGAAGCATTATCAATGG + Intergenic
1036279536 8:7388488-7388510 ATGTAAAGAAGCATAATCATAGG + Intergenic
1036341982 8:7923389-7923411 ATGTAAAGAAGCATAATCATAGG - Intergenic
1037225461 8:16584240-16584262 CTGAAAGGAAGCATAATCATAGG + Intergenic
1037242002 8:16787750-16787772 CTGTCAAGAAGCATATTGAAAGG + Intergenic
1037988411 8:23303859-23303881 AGGGTAAGAAGCATGATTAAGGG + Intronic
1039535318 8:38306155-38306177 CTGGTAAGAATAATAAAAAAAGG + Intronic
1039545626 8:38408954-38408976 TTGCTAGGAAGCATAATTAAGGG + Intronic
1043699309 8:83264593-83264615 CTGATAAAAAGCATAATTAGAGG + Intergenic
1044766961 8:95586798-95586820 CTGGTAAGAAGCAATCTCAATGG - Intergenic
1046093388 8:109529651-109529673 CAGATAAGAAGATTAATCAATGG + Intronic
1048140719 8:131791634-131791656 TTGGAAAGAAGCAGAAACAAAGG + Intergenic
1051603065 9:18893367-18893389 CTGTTAGGAAACATAATCACTGG - Intronic
1051698675 9:19795527-19795549 CTAGAAAGAACCATATTCAAAGG + Intergenic
1053501110 9:38593003-38593025 GTGGTCATCAGCATAATCAATGG - Intergenic
1055857253 9:80704114-80704136 CTGTTAAGAAAAAAAATCAAAGG - Intergenic
1059728959 9:117037329-117037351 CTGGGAAATAGCAAAATCAAGGG - Intronic
1061094295 9:128445751-128445773 CTGGTAATAAAAATAATCCAGGG - Intergenic
1188789000 X:34385491-34385513 CCGATAAGAATCATAAGCAAGGG + Intergenic
1196273557 X:113740293-113740315 CTGGTAATGAGCAAAATCAAAGG - Intergenic
1198832764 X:140768317-140768339 CTTGAATGAAGCATTATCAAAGG - Intergenic