ID: 987078674

View in Genome Browser
Species Human (GRCh38)
Location 5:14406850-14406872
Sequence GACCTGAACCCTGAGGATTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 172}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987078664_987078674 16 Left 987078664 5:14406811-14406833 CCCGTGGTGGGGCAGAGACTTGG 0: 1
1: 0
2: 0
3: 32
4: 343
Right 987078674 5:14406850-14406872 GACCTGAACCCTGAGGATTCAGG 0: 1
1: 0
2: 0
3: 14
4: 172
987078663_987078674 23 Left 987078663 5:14406804-14406826 CCAGGATCCCGTGGTGGGGCAGA 0: 1
1: 0
2: 1
3: 14
4: 105
Right 987078674 5:14406850-14406872 GACCTGAACCCTGAGGATTCAGG 0: 1
1: 0
2: 0
3: 14
4: 172
987078666_987078674 15 Left 987078666 5:14406812-14406834 CCGTGGTGGGGCAGAGACTTGGG 0: 1
1: 0
2: 1
3: 28
4: 270
Right 987078674 5:14406850-14406872 GACCTGAACCCTGAGGATTCAGG 0: 1
1: 0
2: 0
3: 14
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987078674 Original CRISPR GACCTGAACCCTGAGGATTC AGG Intronic
901783681 1:11610669-11610691 GACCGGAACCCTGAAGAACCTGG + Intergenic
903172180 1:21561124-21561146 GAGCTGACCCTTGAGGATGCGGG - Exonic
905347665 1:37322260-37322282 GAGCTGAAGGCTGAGGACTCTGG - Intergenic
909643663 1:77893421-77893443 AACCAGAAACCTGAGGCTTCAGG - Intronic
911268666 1:95774491-95774513 GATCTGAACCCTGATGCTTTGGG - Intergenic
914267031 1:146046916-146046938 CTCCTGACCCCTGAGAATTCTGG - Intergenic
914843219 1:151265288-151265310 GTCCTTAACCCTGAGGAGTGCGG + Intronic
915143214 1:153779454-153779476 TACCTGGAGCCTGAGGAATCGGG - Exonic
915641267 1:157228787-157228809 GAATAGAACCCTGAGGATTAAGG - Intergenic
915902885 1:159858801-159858823 GTCCTGGACCCTGAGGACTATGG - Exonic
919777508 1:201203825-201203847 GACCTGAGGCCTGAGGACTCTGG + Exonic
922526435 1:226308448-226308470 TACCTGAACACTGAGTATCCGGG + Intronic
922715661 1:227869896-227869918 CACCAGAACCCTGAGGAAGCTGG + Intergenic
924479278 1:244413111-244413133 GAACTGGATCCTGAGGATGCTGG + Intronic
1068802553 10:61158516-61158538 GACCTGAAACCTGATGCTTAAGG - Intergenic
1069702648 10:70437959-70437981 CACCTGTACCTGGAGGATTCGGG + Intronic
1071597743 10:86940469-86940491 AACCTGAACCCTGAAAATGCTGG + Intronic
1072431198 10:95372220-95372242 GAGCGGAAGCCTGAGGATTTGGG + Intronic
1074808035 10:117073694-117073716 GACATGAACCCTGAGGCTACTGG + Intronic
1075044284 10:119133756-119133778 GACCTGAACACTGGAGACTCTGG + Intronic
1076145500 10:128116445-128116467 GACCTGATCTTTCAGGATTCTGG + Intronic
1077042210 11:529845-529867 GAGCTGACCCCTTGGGATTCTGG - Intergenic
1079012947 11:16844754-16844776 GGCTTGAACCATGAGGCTTCTGG - Intronic
1079063848 11:17273053-17273075 GACCTGAAAGCTGTGGTTTCAGG - Intronic
1081747563 11:45483653-45483675 GGCCTGAACACTGGGGTTTCCGG - Intergenic
1082735216 11:56847487-56847509 GAGCTTATCCCTGATGATTCTGG - Intergenic
1083279568 11:61618440-61618462 GACCTGAAGCCTGAGCATGGTGG - Intergenic
1084121313 11:67070640-67070662 GACCTACACCCTGAGCGTTCTGG - Intronic
1084505234 11:69562841-69562863 CACCTATACCCTGAGGATGCTGG + Intergenic
1085289164 11:75385093-75385115 AAACTGTACCCTGAGGATTATGG + Intergenic
1085346488 11:75771377-75771399 GTGCTGAACCCTGAGGACACAGG - Intronic
1086305921 11:85481935-85481957 GACCTGGACCCTGGGGCTGCAGG - Intronic
1088045312 11:105443644-105443666 GGCCTGAACCCTGAGTCTGCTGG - Intergenic
1088320304 11:108548542-108548564 TACCTGAACCTTGAATATTCTGG - Intronic
1089002096 11:115060392-115060414 GATCTCAATCCTGAGGGTTCAGG - Intergenic
1089434238 11:118450167-118450189 GACTTGGAACCTGAGGATTCTGG + Intronic
1090331076 11:125932592-125932614 TGGCTGAAGCCTGAGGATTCCGG - Intergenic
1091385756 12:93527-93549 GGCCTGAAGACTAAGGATTCAGG + Intronic
1103383232 12:120511448-120511470 GACCTGAAACATGAGGATAATGG - Intronic
1106872523 13:34037193-34037215 GGGCTGAACCCTGATGGTTCTGG - Intergenic
1107452392 13:40521601-40521623 GATCTGACCCCTGAGGAATTTGG - Intergenic
1108014278 13:46057714-46057736 GACCAAAACCCTGAGGGTTAGGG + Intronic
1108070586 13:46624970-46624992 AAACAGAACCCTGAGGATGCAGG - Intronic
1110484192 13:76019149-76019171 GACTTGAGCACTGAGGATTTTGG + Intergenic
1115301448 14:31890090-31890112 GACTTGAACACTGTGGATTTTGG + Intergenic
1115516665 14:34192197-34192219 ACCCTGAACCCTGACTATTCTGG - Intronic
1117252952 14:53953752-53953774 CACCTGAAGCCAGAGGATTTGGG + Intronic
1119866730 14:77980776-77980798 GACCTGCAGCCTGGGGTTTCAGG + Intergenic
1122161308 14:99786189-99786211 TACCTGAATCTTCAGGATTCAGG + Intronic
1122161309 14:99786191-99786213 ATCCTGAATCCTGAAGATTCAGG - Intronic
1122785082 14:104159858-104159880 GATCTCACCCCTGAGGGTTCAGG - Intronic
1126218340 15:46183350-46183372 GACCTGAAACCTGAGGCTGCAGG + Intergenic
1126690605 15:51286249-51286271 GACCAGAACTCTGGGGATTTGGG - Intronic
1127541860 15:59947270-59947292 GCCCTTAACCCAGAAGATTCTGG + Intergenic
1127556697 15:60094615-60094637 GACTTGAAGCCTGAGGACTTTGG + Intergenic
1128255258 15:66191472-66191494 GACCTGGACCCTGAGGGTCGGGG + Intronic
1128512866 15:68324425-68324447 TGCCTGAACCTTGAGGATTTGGG - Intronic
1132404252 15:101532851-101532873 GACCTGCACACTGAGGCTTGCGG - Intergenic
1132803648 16:1766007-1766029 GACGTGAACCCAGAGGACCCGGG + Exonic
1133147215 16:3797388-3797410 AACCTGAACTCTGAGGATAAGGG - Intronic
1136000647 16:27290132-27290154 GAAATGAAGCCTGAGGATTTGGG + Intronic
1136152425 16:28359736-28359758 GACCTGCACCCTGGGGACCCAGG - Intronic
1136194322 16:28641454-28641476 GACCTGCACCCTGGGGACCCAGG + Intronic
1136210656 16:28755545-28755567 GACCTGCACCCTGGGGACCCAGG + Intronic
1136255373 16:29035514-29035536 GACCTGCACCCTGGGGACCCAGG + Intergenic
1138588913 16:57988796-57988818 GTCCTGAAACCTGGGGCTTCAGG + Intergenic
1140904549 16:79399200-79399222 GATCTGAAACCTGAGGTTCCAGG - Intergenic
1145305677 17:21673832-21673854 GAGCAGAACCCTGAAAATTCAGG - Intergenic
1146648679 17:34592528-34592550 GGCTTGAACCCTGAAGATCCTGG + Intronic
1147043399 17:37735226-37735248 GACTTGAACCTTGAGGATTTTGG - Intronic
1149095784 17:52838805-52838827 GACATGTAGCCTGAAGATTCAGG - Intergenic
1149368311 17:55967518-55967540 GAGCTGAACCCTGAAAATCCTGG + Intergenic
1151404892 17:73879854-73879876 GACCTCAGCCCTGAGGTTGCAGG + Intergenic
1151461331 17:74255942-74255964 GACCTGGGCCCTGAGGACCCAGG + Intronic
1151975916 17:77483470-77483492 TGCTTGTACCCTGAGGATTCAGG + Intronic
1152019296 17:77772075-77772097 GCCCTGAATCCTGGGGATTGGGG - Intergenic
1153923134 18:9808793-9808815 GACCTGATGCCAGAGCATTCTGG + Intronic
1155877971 18:31110808-31110830 CACCTGAACCCTGATGATGAAGG - Intergenic
1156493400 18:37510256-37510278 GAACTGTGCACTGAGGATTCTGG - Intronic
1158490761 18:57907467-57907489 GCCCTGAGCCCTGAGGATGGAGG + Intergenic
1162720786 19:12661394-12661416 GTCCTGAAGCCAGAGGATCCTGG + Intronic
1165509065 19:36255683-36255705 GAGCAGAACCCAGAGGCTTCAGG + Intergenic
1165631626 19:37306348-37306370 AAGCAGAACCCTGAGGCTTCAGG - Intergenic
1166035904 19:40168335-40168357 CACCTGAACCCAGAAGATTGAGG + Intergenic
1166331355 19:42079767-42079789 GACATGAATGCAGAGGATTCGGG - Exonic
1167287440 19:48606567-48606589 GCCCTGAACCCAGAGGACGCTGG - Intronic
1167350475 19:48970899-48970921 GCCCAGGCCCCTGAGGATTCTGG - Intronic
1168087424 19:54058386-54058408 GACCTGAAGCCTAAGGATGCTGG - Exonic
1168523041 19:57067892-57067914 GCGCTGAGCCCTGAGGATGCTGG + Intergenic
925379381 2:3414607-3414629 GCACTGATGCCTGAGGATTCAGG - Intronic
926266497 2:11327180-11327202 GACAAGGACACTGAGGATTCTGG + Intronic
926742869 2:16126645-16126667 GACCTGAAGGTTGAGGATTGAGG - Intergenic
927483646 2:23473675-23473697 GACATGAACTCTGAGGGTTTTGG + Intronic
928151231 2:28831272-28831294 CACCTGAGCCCAGAAGATTCAGG + Intronic
928417483 2:31108186-31108208 CACATGAACCCTGAAGTTTCAGG + Intronic
930739531 2:54816231-54816253 GACCTGAACCCAGGGAATTTAGG + Intronic
932572825 2:72946853-72946875 GACTTGATCCCTGAGGATCAGGG - Intronic
933763093 2:85687499-85687521 GACCCGGACCGTGATGATTCTGG - Intronic
936644062 2:114348814-114348836 GACCTGAATCCTGAGCACACTGG + Intergenic
937238965 2:120447965-120447987 TGCCTGAACCCAGAGGATTTGGG - Intergenic
938723200 2:134084549-134084571 GACCAGCAACCTGAGGATTCTGG - Intergenic
946758183 2:222967119-222967141 GGACTGATCACTGAGGATTCAGG - Intergenic
947467799 2:230369417-230369439 GGCCTGGAGCCTGGGGATTCAGG + Intronic
948490058 2:238306924-238306946 AACCTGGACCCTGGGGGTTCTGG - Intergenic
1169200388 20:3706424-3706446 GACCTGCAGCCCGAGGACTCTGG - Exonic
1171523190 20:25791320-25791342 GAGCAGAACCCTGAAAATTCAGG - Intronic
1171530933 20:25853300-25853322 GAGCAGAACCCTGAAAATTCAGG - Intronic
1171553636 20:26064563-26064585 GAGCAGAACCCTGAAAATTCAGG + Intergenic
1173925862 20:46780749-46780771 GCCTGGAACCCAGAGGATTCTGG - Intergenic
1174041761 20:47705238-47705260 GACCTTACCCCTGAGGCTGCTGG - Intronic
1176309498 21:5142183-5142205 CACCAGAACCCTGTGGATGCTGG + Intronic
1176513085 21:7763330-7763352 GACCTGGACCTTGAGGGTCCAGG + Intronic
1177941470 21:27416935-27416957 GGCCTGAATCCTGAGGCTGCAGG + Intergenic
1178647198 21:34393854-34393876 GACCTGGACCTTGAGGGTCCAGG + Intronic
1178662591 21:34520050-34520072 GTCCTAAACCCTGAGCTTTCTGG - Intronic
1178807422 21:35851160-35851182 AACCTTGACCCTGAGGATTGAGG + Intronic
1179847562 21:44119850-44119872 CACCAGAACCCTGTGGATGCTGG - Intronic
1179965421 21:44801993-44802015 GACCAGGACCCTGAGGCCTCTGG - Exonic
1180176787 21:46094496-46094518 GAGGTGAACTCCGAGGATTCAGG - Intergenic
1180385252 22:12173196-12173218 GACATGAATCTTGAGGAGTCAGG + Intergenic
1184667610 22:45997008-45997030 GAGCTGAGCCCTGAGGGTTCAGG + Intergenic
1184961970 22:47936459-47936481 CACCTGAACCCGGAAGAGTCAGG + Intergenic
949415602 3:3810621-3810643 CACCTGAACCCAGGAGATTCAGG + Intronic
949800316 3:7897103-7897125 GAAATGCACCATGAGGATTCTGG + Intergenic
952035498 3:29196082-29196104 AGCCTGAACCCTGAGTTTTCTGG + Intergenic
953655748 3:44852722-44852744 GAAGTGAATCTTGAGGATTCCGG + Exonic
954265240 3:49466431-49466453 GACCCTCAACCTGAGGATTCAGG - Intergenic
961920697 3:130422751-130422773 GACCTGGACCCAAAGGATTTAGG + Exonic
961990938 3:131190236-131190258 GTCCTGTGCACTGAGGATTCAGG + Intronic
966834601 3:184039196-184039218 AACCTGAATCCTGAGGAGCCAGG - Exonic
966851000 3:184164980-184165002 GCCCTAAACCCTGAGGATGCGGG + Intronic
967636135 3:191804947-191804969 GACCTGAAACCTGGGGCTGCAGG - Intergenic
969521154 4:7678437-7678459 GACCTGAACCCCGGGCAGTCAGG - Intronic
969882653 4:10187911-10187933 CATTTGAAACCTGAGGATTCTGG - Intergenic
972956216 4:44395481-44395503 CACCAGCACCATGAGGATTCTGG + Intronic
973589074 4:52422149-52422171 GACCTGCAACCTGAGGCTCCTGG + Intergenic
980220025 4:129902131-129902153 GACCAGAGCCCTTAGGATTCTGG + Intergenic
980823695 4:138048509-138048531 GACCTCCACCCTAAGTATTCAGG + Intergenic
985055761 4:186034422-186034444 GATCTGTACCCTGAGGGATCGGG - Intergenic
985055784 4:186034557-186034579 GATCTGTACCCTGAGGGATCGGG - Intergenic
987078674 5:14406850-14406872 GACCTGAACCCTGAGGATTCAGG + Intronic
988516016 5:31905416-31905438 TACCTGCAACCTGAGGATGCTGG + Intronic
989401557 5:41013128-41013150 TACCTAAACCTTGAGAATTCAGG + Intronic
989415933 5:41175601-41175623 GACCTGATCCCTAAGCATTTAGG + Intronic
990037697 5:51342266-51342288 GAACTGGACCCTAAGGATTGAGG + Intergenic
995793943 5:115922665-115922687 GGCCTGGATCCTGAGGGTTCTGG + Intergenic
998147865 5:139740497-139740519 GAGAAGAACCCTGAGGCTTCAGG + Intergenic
1000927324 5:167209740-167209762 TCCCTGAACCCTGAGGAATGTGG - Intergenic
1001027453 5:168236230-168236252 GACCTGAACTTTCAGGAGTCAGG - Intronic
1001554917 5:172630694-172630716 GTCCTGAAGCCTGAGGGTCCAGG - Intergenic
1002560928 5:180081571-180081593 GACCAGCAGCCTGGGGATTCAGG + Intergenic
1005730582 6:28693231-28693253 GACTTTTAGCCTGAGGATTCAGG - Intergenic
1007609836 6:43142209-43142231 GACGTGGCCCCTGAGGACTCAGG + Exonic
1008496430 6:52138642-52138664 GATCTGAATACTGAGGATTCTGG - Intergenic
1010951057 6:82037641-82037663 GAGCTGAAGCCTGAGGAGTAAGG - Intergenic
1013166712 6:107600630-107600652 GAGCTGAAGCCTGAGGATAAAGG + Intronic
1013699307 6:112744621-112744643 GACCTGAATCCTGGGGCTTCAGG - Intergenic
1013945776 6:115720451-115720473 GTCTTCAACCCTGAGGGTTCTGG - Intergenic
1016421996 6:143895118-143895140 GAACTTAAGCCTGAGAATTCTGG - Intronic
1017283578 6:152649339-152649361 AACCAGAAGCCTGAGGATGCAGG + Intergenic
1018955848 6:168410246-168410268 CACCTGAGCCCTGGGGAATCCGG - Intergenic
1019496891 7:1345001-1345023 GAGCTGAACCCTGAGAAGGCAGG + Intergenic
1022039351 7:26565420-26565442 GACCTGCACACTGAGGATGGTGG + Intergenic
1022950523 7:35333823-35333845 AACCTGAACCCTGGGGAGACAGG + Intergenic
1025283629 7:57646229-57646251 GAGCAGAACCCTGAAAATTCAGG - Intergenic
1027256043 7:76431322-76431344 GGCCTGACCCCTGAGGATGGTGG + Intronic
1027463989 7:78491737-78491759 GACTTGAAGCTTGAGGATGCAGG + Intronic
1031894325 7:127330810-127330832 TACCTGAACTCTGAGGAAACTGG + Intergenic
1034364676 7:150536115-150536137 GACCTGAAGCCTGAGGCTGTGGG - Intergenic
1034543546 7:151775440-151775462 GAGCTGAACCCTCAGGACTCAGG - Intronic
1037949227 8:23007893-23007915 CTCCTGAACCCAGAAGATTCGGG - Intronic
1039419577 8:37424950-37424972 GAGCTGCACCCTGAGGCTACAGG - Intergenic
1046547805 8:115673622-115673644 GACCAGAAACCTCAGGATTTTGG + Intronic
1047308013 8:123668952-123668974 TACCTGATCCCTGAGGATTGAGG + Intergenic
1047775312 8:128065568-128065590 GCCCTGAACCCTGAGGGTAAGGG + Intergenic
1051109813 9:13623200-13623222 AACCTGAGCCCTGTGGCTTCTGG - Intergenic
1051384720 9:16495353-16495375 GCCATGAACTCTGAGGATTTGGG + Intronic
1052459325 9:28742045-28742067 GACCTGAAGCCTTAGTCTTCAGG + Intergenic
1055591552 9:77820347-77820369 AACCTGAACCCTGACCTTTCAGG + Intronic
1057514853 9:95712439-95712461 GACCTGAATGCTGCTGATTCAGG - Intergenic
1058118652 9:101114402-101114424 GACCTTAAACCTGAAGATCCAGG + Intronic
1061214950 9:129216375-129216397 GGCCTGGACCCTGCGGATGCTGG + Intergenic
1203700673 Un_GL000214v1:131536-131558 GACATGAATCTTGAGGAGTCAGG + Intergenic
1192382754 X:70635635-70635657 GACCTGAAGCCTGGGGCTACGGG - Intronic
1192788200 X:74354713-74354735 GGCCTGAAGCCTGGGGCTTCAGG - Intergenic
1193571188 X:83146464-83146486 GACTTGAATCCAGAGAATTCTGG - Intergenic
1196892385 X:120303969-120303991 CACCTGAAATCTGAGGATCCTGG - Intronic