ID: 987081798

View in Genome Browser
Species Human (GRCh38)
Location 5:14431850-14431872
Sequence ATGGAGAATCAGCAAGAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 442
Summary {0: 1, 1: 0, 2: 2, 3: 35, 4: 404}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987081798_987081805 25 Left 987081798 5:14431850-14431872 CCACCCTCTTGCTGATTCTCCAT 0: 1
1: 0
2: 2
3: 35
4: 404
Right 987081805 5:14431898-14431920 TTTCTGTAAGAACACCAGTCAGG 0: 1
1: 0
2: 1
3: 20
4: 155
987081798_987081806 29 Left 987081798 5:14431850-14431872 CCACCCTCTTGCTGATTCTCCAT 0: 1
1: 0
2: 2
3: 35
4: 404
Right 987081806 5:14431902-14431924 TGTAAGAACACCAGTCAGGTTGG 0: 1
1: 4
2: 31
3: 332
4: 1115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987081798 Original CRISPR ATGGAGAATCAGCAAGAGGG TGG (reversed) Intronic
900704369 1:4070702-4070724 ATGTAGAATCAGAGAGAGGAAGG + Intergenic
901179782 1:7333661-7333683 TTGGAGAATCTGCAACATGGCGG - Intronic
901244120 1:7715194-7715216 AAGGAAAATCAGGAAAAGGGGGG + Intronic
902104912 1:14026886-14026908 ATGGAGGAACAGCCAGATGGGGG + Intergenic
902242237 1:15096715-15096737 ATGGGGAAGAAGGAAGAGGGAGG + Intronic
902314328 1:15606508-15606530 CTGGAGAATGAGGGAGAGGGAGG - Intergenic
902381590 1:16055405-16055427 GTGGAGAGACAGCCAGAGGGAGG - Intronic
903549279 1:24146537-24146559 AGGGAGAATCAGGAAGAATGAGG + Intergenic
905359772 1:37411248-37411270 GTGGTGAATCAGCCACAGGGAGG + Intergenic
905541705 1:38765204-38765226 GTGGAGAATAAGAAAGAGTGGGG - Intergenic
907392583 1:54167981-54168003 CTGGGGATGCAGCAAGAGGGAGG + Intronic
908308170 1:62846831-62846853 ATTGAGAACCAGCTAGAGGCAGG - Intronic
908324661 1:63012049-63012071 ATGGAGAGGTAGGAAGAGGGAGG - Intergenic
908776958 1:67649701-67649723 AAGGAGAATCAGGAGGAGGTAGG + Intergenic
908838215 1:68249995-68250017 GTGAAGAGACAGCAAGAGGGTGG - Intergenic
908940863 1:69431729-69431751 ATAGAGAATTAGGAAGAGTGAGG + Intergenic
910017555 1:82546350-82546372 GAGGAGCATCAGAAAGAGGGAGG + Intergenic
910769341 1:90815376-90815398 ATGAAGAATTAGCAAGAATGGGG + Intergenic
911014732 1:93320280-93320302 AAGCAGAATGAGCAAGAGGTGGG - Intergenic
911595332 1:99793289-99793311 ATGAAGACACAGCAAGATGGTGG - Intergenic
911930884 1:103902054-103902076 AAGGAGAATTGGCAAGGGGGAGG + Intergenic
913505526 1:119513198-119513220 ATGCACAATCAGGAAGAGTGTGG + Intronic
913665588 1:121045348-121045370 TTGGAGATTGAGCAAGAAGGAGG - Intergenic
914016986 1:143828618-143828640 TTGGAGATTGAGCAAGAAGGAGG - Intergenic
914160799 1:145132380-145132402 TTGGAGATTGAGCAAGAAGGAGG + Intergenic
914655595 1:149737160-149737182 TTGGAGATTGAGCAAGAAGGAGG - Intergenic
915488727 1:156239890-156239912 CTGGGGAACCAGCAGGAGGGGGG - Intronic
915570520 1:156743027-156743049 ATGGAGCATCAACAGCAGGGTGG - Intronic
916080398 1:161228631-161228653 ATGGGGAATCAGCAGAATGGAGG - Intronic
916398762 1:164422430-164422452 AAAGAGAAACAGCAAGAGAGAGG - Intergenic
916989565 1:170227651-170227673 ATGGAGAATGAGGAAAGGGGAGG + Intergenic
918455835 1:184712892-184712914 ATAGAGAATCAACAGCAGGGAGG + Intronic
918743339 1:188165498-188165520 ATGAAGACACAGCAAGAAGGTGG - Intergenic
919038986 1:192357411-192357433 AGGGAGACACAGAAAGAGGGAGG + Intronic
919657126 1:200208163-200208185 GTGAAGAAGCAGCAAGAAGGCGG + Intergenic
920958843 1:210645956-210645978 AGGGTGAAGCAGCAACAGGGAGG - Intronic
921009694 1:211129014-211129036 CTGGAGAACCATCAGGAGGGAGG + Intronic
921824359 1:219655450-219655472 ATGGAAATTAAGCAAGAGGCAGG - Intergenic
921930468 1:220750077-220750099 AAGCAGAATCACCAAGAGTGGGG + Intronic
922433207 1:225576729-225576751 ATGAAGAGGCAGCAAGAGGGCGG + Intronic
922499543 1:226086359-226086381 ATGGAGAGACAGCCAGATGGAGG - Intergenic
922722739 1:227906836-227906858 AAGGAGGATGAGGAAGAGGGAGG - Intergenic
923495584 1:234521719-234521741 ATGGAGAAGCAGCAAGGGGCAGG - Intergenic
923915028 1:238492311-238492333 TTGGAGAACCAGCCTGAGGGAGG + Intergenic
924517155 1:244775770-244775792 ATGGTTACTCAGCAAGTGGGTGG - Intergenic
1064020086 10:11801977-11801999 CTGGAGACTCAGAAGGAGGGAGG + Intergenic
1064245457 10:13664353-13664375 ATGGAGTGTCAGAAAGAGGTTGG + Intronic
1064358991 10:14646342-14646364 CTGGAGACTCAGGAGGAGGGAGG - Intronic
1064832409 10:19485162-19485184 TTGGAAACTCAGAAAGAGGGAGG + Intronic
1065123872 10:22554530-22554552 GTGCAGAAACAGCCAGAGGGTGG + Intronic
1065661039 10:28004421-28004443 CTGGATCATCAGGAAGAGGGAGG - Intergenic
1065954569 10:30682545-30682567 ATGGTGACTCAGAAAGATGGTGG - Intergenic
1066295748 10:34052807-34052829 CGGGAGAAGGAGCAAGAGGGTGG - Intergenic
1066609345 10:37222656-37222678 ATGGAGGAACAGCATGAGGAAGG - Intronic
1066705984 10:38178493-38178515 AAGGAAAATAAGCAAGAGTGGGG - Intergenic
1067094784 10:43293203-43293225 AGAGAGACTGAGCAAGAGGGAGG + Intergenic
1067205767 10:44211500-44211522 CAGGAGAAGCAGCATGAGGGGGG - Intergenic
1068285172 10:54924142-54924164 ATGGTGAAGCAGGAAGTGGGGGG + Intronic
1070347334 10:75557661-75557683 ATTGAGAATCAGCTAGAGCTGGG + Intronic
1070574986 10:77670935-77670957 AGGGAGAAACAGAAAGAGAGAGG + Intergenic
1070653629 10:78255702-78255724 ATGGAAAAGCAGTAAGAGGCTGG - Intergenic
1071117316 10:82236674-82236696 ATGGAGAAGGAGATAGAGGGAGG - Intronic
1071270924 10:84006608-84006630 AAGGAGAAAGAGCAAGAGGGAGG - Intergenic
1071435965 10:85648506-85648528 ATGGTGACTCAGAGAGAGGGAGG - Intronic
1071952812 10:90724194-90724216 ATAGAAAAACAGCAAGAAGGGGG + Intergenic
1072200669 10:93155873-93155895 ATGGAGAATAAGAAAAAGGAAGG + Intergenic
1075396258 10:122129853-122129875 ATGGAGAATAAGCAGTAGTGTGG + Intronic
1075627728 10:123974552-123974574 AAGGAGAAGGAGCAAGAGTGAGG - Intergenic
1076211724 10:128652406-128652428 ATGAAGAATCAAGAAGAAGGGGG + Intergenic
1076470359 10:130714210-130714232 ATCCCCAATCAGCAAGAGGGAGG + Intergenic
1078540784 11:12211446-12211468 AGTGAGAATCAGCATGAGGCTGG + Intronic
1078727432 11:13944067-13944089 ATGGAGCATTAGCAAATGGGAGG + Intergenic
1078799306 11:14627024-14627046 ATGAAGACACAGCAAGAAGGGGG - Intronic
1079186392 11:18241736-18241758 CTGGAGACTCAGAAAGATGGAGG + Intronic
1079237684 11:18701510-18701532 ATGAAGAATGAGTAACAGGGTGG - Intronic
1079339429 11:19599777-19599799 TTTGAGAAACAGCATGAGGGAGG + Intronic
1080683554 11:34497055-34497077 TTGAAGAATCAGAAAGAGGATGG + Intronic
1081776983 11:45682317-45682339 ATGGCGAATCTCCAAGAGGGAGG + Intergenic
1083356321 11:62068988-62069010 ATGGTGAGTCAGAAAGAGAGGGG + Intergenic
1083687368 11:64384636-64384658 AGGGAGAATCAGAAAGAGTGGGG - Intergenic
1083859389 11:65411867-65411889 ATGGAGCACCAGCAGGAGGAAGG - Exonic
1086539356 11:87889246-87889268 CTGTAGAATCAGTCAGAGGGAGG - Intergenic
1087534868 11:99430627-99430649 ATGGAGAGAGAGCAAGAGAGAGG + Intronic
1087603524 11:100345876-100345898 ATAGAGAACCAGCAAGATGTTGG + Intronic
1088303750 11:108386615-108386637 ATGGAAAAGCACCAAGAGGCAGG + Intronic
1088447302 11:109945868-109945890 ATGGAGAAACAGAAACATGGAGG - Intergenic
1091004089 11:131936478-131936500 TTGGAGACTCAGAAGGAGGGTGG + Intronic
1091344235 11:134842263-134842285 CGGGACAATCAGCAGGAGGGAGG + Intergenic
1091394314 12:144191-144213 ATGGAGAAGCAGAAAGTGGCAGG + Intronic
1092965105 12:13633851-13633873 AGGGAGAATCAGAAACAGGTGGG - Intronic
1093291743 12:17333226-17333248 ATGGAGAATAAGTTAGAAGGTGG - Intergenic
1094438218 12:30445288-30445310 GTGAAGAGGCAGCAAGAGGGTGG + Intergenic
1095154648 12:38837629-38837651 CTGGAGAAGCAGCAAGGGAGAGG + Intronic
1095351584 12:41220274-41220296 CTGAAGACACAGCAAGAGGGTGG - Intronic
1096883788 12:54696673-54696695 ATGGTGAAGCAGAAAGAGAGTGG + Intergenic
1097596326 12:61636855-61636877 ATGGATAATCACAAAGAGGCAGG + Intergenic
1098401444 12:70080866-70080888 ATTGAGAAACAGCAGCAGGGAGG + Intergenic
1099189362 12:79546889-79546911 ATAGAGAATCAGAAAGACTGTGG + Intergenic
1100157983 12:91823856-91823878 GTGGAGATTCAGCAATGGGGTGG + Intergenic
1100787462 12:98093958-98093980 CTGGAGAATCAGTGGGAGGGTGG - Intergenic
1100893853 12:99157643-99157665 CTGGAGACTCAGAAAGGGGGAGG + Intronic
1101464474 12:104933906-104933928 CTGGAGACTCAGAAAGGGGGAGG + Intronic
1102401347 12:112632355-112632377 TTGGAGACTCAGAAAGATGGAGG - Intronic
1102845459 12:116176786-116176808 ATTGAGAAAAAGCAAGGGGGAGG + Intronic
1103807184 12:123582790-123582812 ATGGAGAAACAGCAAGACTTTGG + Intergenic
1104469466 12:129018075-129018097 ATGGAGGGTCAGCTTGAGGGTGG - Intergenic
1104915031 12:132260167-132260189 ATGGAGAAACAGACACAGGGAGG + Intronic
1105899394 13:24742541-24742563 TTCAAGAAGCAGCAAGAGGGAGG - Intergenic
1105961879 13:25349288-25349310 ATGGAGAAAGATCAACAGGGAGG - Intronic
1106232062 13:27828117-27828139 TTGGAGAATTAGGCAGAGGGCGG - Intergenic
1106289906 13:28350969-28350991 ATGGAGAAACAGAGAGACGGTGG - Intronic
1110137610 13:72087534-72087556 ATGGAGCATCTGCAATAGAGGGG - Intergenic
1112025814 13:95409896-95409918 ATGGACTATGAGCAAGAGGCTGG - Intergenic
1113070037 13:106411428-106411450 ATGAAGAGGCTGCAAGAGGGTGG - Intergenic
1113363764 13:109656565-109656587 ATGGATAATCTGCAAGTGGGAGG + Intergenic
1113990299 14:16023158-16023180 CTGGAGTGTCAGCAAAAGGGAGG + Intergenic
1114418635 14:22561016-22561038 ATGGAGACTCAGCAAGTGTTAGG - Intergenic
1115196776 14:30809304-30809326 ATGAAGACTCTGCAAGAGGCTGG + Intergenic
1115360004 14:32489926-32489948 AAAGAGAGTCAGCAAAAGGGTGG + Intronic
1115740382 14:36381550-36381572 TTGGAGACTCAGAAAGAGGGAGG + Intergenic
1115947592 14:38679674-38679696 ATGGAGACTCAGAAGGAGGAGGG - Intergenic
1117207162 14:53455300-53455322 CTGGAGACTCAGAAAGAGTGAGG + Intergenic
1117636895 14:57753734-57753756 GTGGAGAATCAGGAAGAGGTTGG - Intronic
1117704870 14:58454772-58454794 GTGAAGAGACAGCAAGAGGGAGG - Intronic
1118660771 14:68008219-68008241 ATTTATAATCAGCAAGAGGATGG + Intronic
1118856833 14:69629586-69629608 AAGGAGCATCTGCAAGAGAGTGG - Intronic
1119687802 14:76646620-76646642 ATGAGGATACAGCAAGAGGGTGG - Intergenic
1121096782 14:91222918-91222940 ATGCGGACTCAGCAAGAAGGCGG - Intronic
1123875240 15:24617536-24617558 ATGGAGAACCACCACTAGGGGGG - Intergenic
1126475250 15:49058954-49058976 ATGGAGACTCAGAAGGAGGAAGG + Intergenic
1128611189 15:69074705-69074727 TTGAAGCATTAGCAAGAGGGTGG - Intergenic
1128766380 15:70253547-70253569 GCGGAGAAGCAGCTAGAGGGAGG + Intergenic
1128787002 15:70405022-70405044 ATGAAGACACAGCAAGAAGGTGG + Intergenic
1128818857 15:70634328-70634350 AAGGAGAAGCAGCTGGAGGGGGG + Intergenic
1128979370 15:72175367-72175389 AAGGAGCATCAGCAGGAGAGTGG - Intronic
1129493286 15:75950876-75950898 ATGGATAAAAAGCAAAAGGGAGG - Intronic
1129595706 15:76962497-76962519 ATGGAGAAACCGGTAGAGGGTGG - Intergenic
1129862287 15:78872421-78872443 CTTTAGGATCAGCAAGAGGGTGG - Intronic
1131390450 15:92043881-92043903 AGGGAGAAACAGGAGGAGGGAGG - Intronic
1131778591 15:95829231-95829253 ATGGCGGCTCAGGAAGAGGGAGG - Intergenic
1133162380 16:3920584-3920606 ATGGAGAAGCAGGCAGAGGACGG - Intergenic
1133875926 16:9734267-9734289 CTGGCGAAACAGCAAGAGGGAGG - Intergenic
1134186115 16:12086302-12086324 ATGTAGAATTGGCAAGAGCGTGG - Intronic
1135116759 16:19730250-19730272 ATTTAAAATCAGCAAGAGGCCGG - Intronic
1138075727 16:54040728-54040750 GTGGAGAAACAGGAAGAGAGTGG + Intronic
1139142240 16:64280504-64280526 ATGGACAATCAGCAGGATGTGGG - Intergenic
1139432253 16:66917546-66917568 AAAGAGAAACAGCAAGAGGAAGG + Intronic
1140963623 16:79942304-79942326 ATGAAGAGGCAGCAAGGGGGTGG - Intergenic
1141112546 16:81282046-81282068 AAGGAGACTCAGCTAGAGAGTGG + Intronic
1141270990 16:82541123-82541145 AGGGAGAGTCAGGAGGAGGGAGG + Intergenic
1141351406 16:83301381-83301403 ATGGAAAATCACAGAGAGGGAGG - Intronic
1141867696 16:86762059-86762081 ATGGAAAATCAGAATGAGGAAGG + Intergenic
1143459714 17:7094434-7094456 ATGGGGAATCAGGAAGAGGAAGG - Intergenic
1143537771 17:7551371-7551393 GTGGGGAAGCAGCAAGAGGCTGG - Intronic
1144578853 17:16446799-16446821 ATGGGGATACAGCAAGACGGGGG - Intronic
1148440763 17:47710637-47710659 ACGGAGAAACAGCCAGTGGGTGG - Exonic
1148446235 17:47739287-47739309 ATGGAGACACAGGAAGAGGCTGG - Intronic
1148767805 17:50049423-50049445 GTGGAGAAACAGCAAAAGGCTGG + Intergenic
1148932217 17:51136400-51136422 ATAGAGAGACAGCTAGAGGGAGG + Intergenic
1149657729 17:58319122-58319144 ATGGAGCAGCAGCAGGGGGGTGG + Exonic
1150139581 17:62716889-62716911 AAGGACAAGCAGCAGGAGGGTGG + Intronic
1150355392 17:64479793-64479815 GTAGAGAATGAGGAAGAGGGAGG + Intronic
1151352039 17:73537514-73537536 ATGGAGAGGCAGGCAGAGGGTGG + Intronic
1151410575 17:73924816-73924838 ATGAAGACACAGCAAGAGGTCGG + Intergenic
1152914454 17:83026203-83026225 CTGGAGAACCAGCGAGAGCGTGG + Intronic
1153730545 18:8007093-8007115 ATTCAGAATCAGCAAGTGAGAGG - Intronic
1153999247 18:10469805-10469827 ATGCAGAGTGAGCAAGAGGCTGG + Intronic
1154031558 18:10757601-10757623 ATGGGGGATGAGGAAGAGGGAGG + Intronic
1154145205 18:11861247-11861269 AAGGAGAGCCAGCAGGAGGGAGG - Intronic
1156020120 18:32589943-32589965 AAGGAGTCTCAGAAAGAGGGTGG + Intergenic
1156839804 18:41598017-41598039 ATGGAAAATGACCTAGAGGGAGG - Intergenic
1157675050 18:49562457-49562479 TTGAAGAATCAGCAAGACAGAGG - Intronic
1157775159 18:50388772-50388794 CTTGAGCATCAGCAAGAGGAAGG - Intronic
1158234225 18:55295035-55295057 ATGGAGAATCAAAAACAGGTTGG + Intronic
1158581569 18:58688852-58688874 ATTGAGAATCACCAAGAGGCCGG + Intronic
1158835881 18:61331726-61331748 AAGGAGAAGGAGGAAGAGGGAGG - Intergenic
1159075987 18:63682776-63682798 AGGGAGAATCTGGAACAGGGAGG - Intronic
1159158353 18:64611478-64611500 ATGGAGAAGGCTCAAGAGGGAGG - Intergenic
1159636110 18:70806855-70806877 CTGGGGAAACAGCAAGAGAGAGG - Intergenic
1159801301 18:72903244-72903266 TTGGAGAATCAGAAGAAGGGAGG - Intergenic
1160867591 19:1262620-1262642 AGTGAGAACCAGAAAGAGGGTGG - Intronic
1161553639 19:4928313-4928335 ATGGCAAATCATCAGGAGGGGGG + Intronic
1161932448 19:7349900-7349922 ATTCAGAATCTGCAACAGGGAGG - Intronic
1162444816 19:10716343-10716365 ATGGAGAAAGAGGAGGAGGGTGG - Intergenic
1162930026 19:13952938-13952960 AGGGAGAATCAGGAGGAAGGGGG + Intronic
1163453993 19:17395241-17395263 AAGGAGAAACAGGAAGAGGAGGG - Intergenic
1164342007 19:24412053-24412075 TTGTAGAATCTGCAAGAGGATGG + Intergenic
1164934677 19:32201565-32201587 AAGGAGAATCAGCAGGGTGGAGG + Intergenic
1164958581 19:32406938-32406960 ATGGAGAATCTGGAACAGAGAGG - Intronic
1165395809 19:35563071-35563093 ATGGAGAAATAGAGAGAGGGAGG - Intronic
1165595477 19:37008784-37008806 CGGGAGACACAGCAAGAGGGAGG - Intronic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166540866 19:43604820-43604842 ATGGAGAAAAAGGAACAGGGTGG - Intronic
1166912692 19:46171320-46171342 AAGGGGAGTCAGCCAGAGGGAGG + Intergenic
1167103638 19:47418728-47418750 ATAGAGAGGCAGAAAGAGGGGGG + Intronic
1167793385 19:51693966-51693988 ATGGAGACTCAGAGAGGGGGAGG + Intergenic
1168084190 19:54033319-54033341 GTGGAGACACAGCAAGAAGGCGG - Intergenic
926119899 2:10236215-10236237 ATGGAGAAGAGGGAAGAGGGTGG - Intergenic
928378914 2:30801757-30801779 ATGGAGACTGAGGAAGAGAGTGG + Intronic
928921812 2:36534580-36534602 AGGGAGAGACAGGAAGAGGGAGG + Intronic
929288516 2:40163468-40163490 AGGGTGAATGAGGAAGAGGGAGG + Intronic
929756946 2:44774924-44774946 AGGGAAAATCAGCAAGGGGCGGG - Intergenic
930090025 2:47525355-47525377 ATGGAGTGTCAGCAAGAGCCCGG + Intronic
930246887 2:48992678-48992700 ATAGAGACAGAGCAAGAGGGTGG - Intronic
930524527 2:52511060-52511082 ATGGAGACTCAGTAACAGGATGG + Intergenic
931117140 2:59177162-59177184 ATGGGGAATCAGCAGGAAAGAGG - Intergenic
932236509 2:70125001-70125023 GTGGAAAATGAGGAAGAGGGCGG + Intergenic
933139521 2:78776911-78776933 ATGTAGGCTCAGCTAGAGGGAGG + Intergenic
933509763 2:83225686-83225708 ATGGAGAATAAGGAAAAGGGTGG + Intergenic
935143607 2:100378026-100378048 AGGGAGAAACAGAAAGAGGTAGG - Intergenic
935489497 2:103698857-103698879 ATAGAGAACCAGCAGCAGGGTGG - Intergenic
938168690 2:129056348-129056370 ATGGTGAATTAGAAAGAGGCTGG + Intergenic
938719786 2:134056341-134056363 ATTAAGATTCAGCGAGAGGGAGG - Intergenic
941036528 2:160574927-160574949 ATGGTGAGTCATCCAGAGGGAGG - Intergenic
941567149 2:167123637-167123659 GTGAAGAGGCAGCAAGAGGGAGG - Intronic
941884898 2:170517801-170517823 ATTTAGAATCTCCAAGAGGGGGG + Intronic
942166303 2:173244118-173244140 CTGGAGACGCAGCAAGTGGGAGG + Intronic
943381440 2:187154352-187154374 ATGGAGAATAAGCAAGAACAAGG - Intergenic
943567968 2:189539257-189539279 ATAGAGAATCAAGAAGAGGGAGG + Intergenic
945126452 2:206516542-206516564 ATGAAGACACAGCAAGAAGGTGG - Intronic
946115496 2:217458427-217458449 AAGGAGAATAAGAAAGAGGCTGG - Intronic
946498188 2:220217396-220217418 ATGGGAAGTAAGCAAGAGGGAGG - Intergenic
946699336 2:222395900-222395922 ATGAAGAGGTAGCAAGAGGGTGG - Intergenic
946706031 2:222459778-222459800 ATGGTGAATCAGGAAGAGCATGG - Intronic
946773920 2:223117877-223117899 ATGGAGACACAGGAAGAAGGAGG + Intronic
946859013 2:223982306-223982328 ATGGAGACTCAGAAGGAGGAGGG + Intronic
948192038 2:236066795-236066817 AGGGAGAATAAACAGGAGGGGGG - Intronic
948417261 2:237819401-237819423 GTGGAGAACCAGGAAGTGGGAGG + Intronic
1169513731 20:6294267-6294289 CTGGAGACTCAGAAAGGGGGAGG - Intergenic
1169709654 20:8547524-8547546 ATGGGCAATGAGGAAGAGGGAGG - Intronic
1169825629 20:9765654-9765676 AGGGAGAAGCAGGGAGAGGGCGG - Intronic
1170328275 20:15179996-15180018 ATGAAGAGTAAGCAAGAGGGTGG - Intronic
1170466575 20:16627842-16627864 CTGGAGAAGGAGCAAGAGAGAGG + Intergenic
1170936122 20:20811250-20811272 ATGGAGAAGCAGCAAGAGTCTGG + Intergenic
1170962692 20:21039443-21039465 GTGGAGCATCAGCAAGTGGCTGG - Intergenic
1171813528 20:29763747-29763769 CTGGAGTGTCAGCAAAAGGGAGG - Intergenic
1171823620 20:29876214-29876236 CTGGAGTGTCAGCGAGAGGGTGG + Intergenic
1171896469 20:30814131-30814153 CTGGAGTGTCAGCGAGAGGGTGG - Intergenic
1172275339 20:33676120-33676142 CTGGGGAATCAGCAAAGGGGAGG - Exonic
1172320636 20:33993366-33993388 ATGGAGAATCGCCCAGAGGGCGG - Intergenic
1173063967 20:39691738-39691760 AGGGAGTAAAAGCAAGAGGGTGG + Intergenic
1173375572 20:42479570-42479592 GTGGAAAATAAGCAAGAGAGTGG - Intronic
1174718235 20:52783482-52783504 ACGGAGAATCAGAAAGTGGCAGG + Intergenic
1174842697 20:53915261-53915283 AAGGAGAATAAGAGAGAGGGAGG + Intergenic
1175499785 20:59441631-59441653 ATGGAGAATGACAAGGAGGGAGG + Intergenic
1175617556 20:60414020-60414042 CTTGAGAATCAGAAAGGGGGAGG - Intergenic
1175651215 20:60725362-60725384 AGTGAGAATCAGCAACATGGAGG - Intergenic
1175774159 20:61642344-61642366 ATGGGGAACCAGCAGGTGGGTGG + Intronic
1175844057 20:62049421-62049443 AGACAGAATCAGAAAGAGGGCGG - Intronic
1176361147 21:5997689-5997711 ATGAAGAGGCAGCAAGAGGGTGG + Intergenic
1177606255 21:23381354-23381376 CACGAGAAGCAGCAAGAGGGAGG - Intergenic
1178083484 21:29089915-29089937 AAGGAGAATAAGAAAGAAGGAGG + Intronic
1178342033 21:31793892-31793914 TTGGAGAATTAGCCACAGGGAGG - Intergenic
1178775332 21:35544774-35544796 AGGGAGGATCAGCAAGAGGCAGG - Intronic
1178909650 21:36664287-36664309 CTGGAGAAGCAGCAGGAGTGAGG + Intergenic
1179188570 21:39104338-39104360 ATAGAGAAACAGAAAGAAGGAGG + Intergenic
1179762371 21:43540861-43540883 ATGAAGAGGCAGCAAGAGGGTGG - Intronic
1180316973 22:11284368-11284390 CTGGAGTGTCAGCAAAAGGGAGG - Intergenic
1181885192 22:26016627-26016649 ATGGAGGAACAGAAAGATGGGGG - Intronic
1182890863 22:33817887-33817909 ATGGAGAAGCTGAAGGAGGGAGG + Intronic
1183958691 22:41397807-41397829 CTGGTGGATCACCAAGAGGGCGG + Exonic
1184379779 22:44138048-44138070 ACAGAGAATGAGCAAGTGGGTGG + Intronic
951110841 3:18802043-18802065 ATGGGGAAGCAGCCAGATGGAGG - Intergenic
951810143 3:26689609-26689631 ATGGAGAAAGAGCAGGAGAGAGG - Intronic
953063550 3:39448620-39448642 ATAGAGAAGCAGCAAAAGAGTGG + Intergenic
953236859 3:41114452-41114474 AGGGAGAGTCAGAGAGAGGGAGG + Intergenic
954392775 3:50276109-50276131 AGGGAGAATCCGAAAGAGGCGGG - Intronic
955206611 3:56901341-56901363 ATGGAGAGTAAACAAGAGAGTGG + Intronic
955527954 3:59840185-59840207 ATGGGGAATCTGCAAGAATGGGG - Intronic
956832237 3:73062785-73062807 ATGCAGAATCAGCCATAGGTTGG + Exonic
957656956 3:83092631-83092653 GTGAAGAAGTAGCAAGAGGGTGG + Intergenic
957973741 3:87416928-87416950 GTGGAGACACAGCAAGAAGGTGG + Intergenic
958085753 3:88804206-88804228 AATGAGAATCAGGCAGAGGGAGG + Intergenic
958178325 3:90024639-90024661 GTGGAGAATGAGTGAGAGGGAGG - Intergenic
958262368 3:91396612-91396634 TAAGAGAATTAGCAAGAGGGAGG - Intergenic
959467475 3:106705775-106705797 ATTGAGAATGAGCAAAAGGGTGG + Intergenic
960275819 3:115728105-115728127 ATGGAGAGACAGCATGAGGGAGG + Intergenic
961373355 3:126446190-126446212 CTGGAGAATCTGCAGGAGTGGGG + Intronic
962378559 3:134878323-134878345 ATGGAGAATTAGCCAGATGTGGG + Intronic
965093483 3:164192754-164192776 ATGGAGAATTAAGAAGAGTGAGG + Intergenic
965553478 3:169995544-169995566 ATGTAAAACCAGAAAGAGGGGGG - Exonic
966025964 3:175282474-175282496 AAGGAGAAAGAGGAAGAGGGAGG + Intronic
966306117 3:178536806-178536828 AGTGAGAAGCAGCAAGAGGAGGG + Intronic
969471082 4:7389689-7389711 CTTGAGAATGAGCAGGAGGGAGG + Intronic
971629322 4:28969351-28969373 ATGAAGACACAGCAAGAAGGAGG + Intergenic
973899301 4:55451394-55451416 AGGAAGAATCAACAACAGGGGGG - Intronic
974274369 4:59698187-59698209 AAGGAGAATGAGGAAGAGGAGGG + Intergenic
975470687 4:74762624-74762646 AAGGAGAATGAGAAAGAGGGTGG + Intronic
975955388 4:79831051-79831073 ATGGAAAATTAGGAAGAGGGAGG + Intergenic
976191084 4:82487698-82487720 TTGGAAAATCAGCAAAATGGTGG + Intronic
977270274 4:94909651-94909673 ATGTAAAATCAGGAAGAGGGAGG - Intronic
977608358 4:99005905-99005927 TTGGAGACTCAGAAAGGGGGAGG + Intronic
978404477 4:108364724-108364746 ATGGGGAAGCAGGAGGAGGGTGG - Intergenic
978420171 4:108523915-108523937 ATGAGGAATCAGCAAGAAGATGG - Intergenic
978835350 4:113142722-113142744 ATGAAGAAAAAGAAAGAGGGGGG + Intronic
979131209 4:117047539-117047561 AAGGAGAAGCAGGAAGAGAGGGG - Intergenic
980328485 4:131379730-131379752 ATGGACAATCAGCAGGATGTGGG + Intergenic
981455126 4:144944846-144944868 ATGGAGGATCATCATGAGGCAGG - Intergenic
984579299 4:181493039-181493061 ATGAAGAATAAGCACCAGGGAGG + Intergenic
984732385 4:183079832-183079854 ATGGAGAAGCAGCAGGAGCCAGG + Intergenic
985031392 4:185794260-185794282 ATGGAGAAGGAGGAGGAGGGAGG + Intronic
985314426 4:188640481-188640503 ATGGAGAAAGGGCAAGAGGGAGG - Intergenic
985785204 5:1889713-1889735 CTGGAAACTCAGCAGGAGGGTGG - Intergenic
986266633 5:6196703-6196725 ATGTAGAGGCAGCAAGAGGATGG + Intergenic
987081798 5:14431850-14431872 ATGGAGAATCAGCAAGAGGGTGG - Intronic
987315704 5:16721212-16721234 TTTGTGAATCAGCAAGAGGAGGG - Intronic
987877211 5:23693161-23693183 ATGAAGAATTTTCAAGAGGGTGG + Intergenic
988330366 5:29830303-29830325 ATGGAGAAACAGCCAGATGGTGG + Intergenic
988861223 5:35281992-35282014 CTGGAGAGTCAGCAGGAGGAGGG + Intergenic
991963805 5:72071534-72071556 ATGGAGACTAACCAAGATGGTGG + Intergenic
992092040 5:73326036-73326058 GTGGAGAGGCAGCAAGAGGGTGG - Intergenic
992403615 5:76434347-76434369 TTGGAGACTCAGAAAGAGGAGGG - Intronic
992546280 5:77817089-77817111 ATCTAAAATCAGCAAGAGGGTGG + Intronic
992969951 5:82046169-82046191 TTGGAGAAGCAGGAAGAGGTAGG - Intronic
993165064 5:84342401-84342423 ATGGAGACTCAGAAAGGTGGGGG + Intronic
993447215 5:88027938-88027960 ATCTAGAAACAGCTAGAGGGTGG + Intergenic
994148753 5:96423821-96423843 ATGGAGAATCAGGATTTGGGGGG - Intronic
997291433 5:132738534-132738556 GTGCAGAAGAAGCAAGAGGGAGG - Intergenic
999320807 5:150613952-150613974 ATGGGGAATCAGAAGGAGGCTGG + Intronic
999325611 5:150641550-150641572 ATGGAGGATCCACAGGAGGGAGG - Intronic
999685161 5:154096214-154096236 ATGGTGACTCAGCAGGAGGCAGG - Intronic
1000022621 5:157331608-157331630 ATGGAGAATCATTAAGAGGGGGG + Intronic
1001136747 5:169108773-169108795 ATGGAGAAGCTCCAAGAGGGTGG + Intronic
1001427018 5:171629392-171629414 ATGGAGGCTCAGAGAGAGGGAGG + Intergenic
1001895345 5:175374601-175374623 TTGGAGACTCAGAAGGAGGGAGG - Intergenic
1003056766 6:2828043-2828065 AAGAAGAATTAGCAAGAGGATGG - Intergenic
1004266676 6:14154112-14154134 ATGGACAATAAGCAGGAGGCAGG - Intergenic
1007077301 6:39075858-39075880 ATGGAGGCTGTGCAAGAGGGAGG + Intronic
1007329693 6:41095958-41095980 ATGGAGTATCAGCAAATGGGAGG - Intronic
1007452873 6:41953531-41953553 ATGGAGAACCAGTAAGAATGGGG + Intronic
1007926039 6:45650594-45650616 AGGGAGAGTCAGGGAGAGGGAGG + Intronic
1007971309 6:46054750-46054772 GTGGAGATACAGCAAGACGGTGG + Intronic
1007994843 6:46295834-46295856 TTGGGGAAGCAGCAGGAGGGAGG + Intronic
1008544395 6:52573150-52573172 ATGGAGAATGAGGAAAAAGGGGG - Intronic
1010922820 6:81704872-81704894 AGGGAGGAAGAGCAAGAGGGAGG + Intronic
1011459209 6:87586106-87586128 ATGGAGAATGAACTGGAGGGAGG + Intronic
1011501904 6:87999858-87999880 ATGAAAAAGCAGCAAGAGGATGG + Intergenic
1011745320 6:90402783-90402805 GTGGAGAGGCAGGAAGAGGGAGG + Intergenic
1011963371 6:93120400-93120422 ATAGAGAATGAGTGAGAGGGAGG - Intergenic
1012049277 6:94319681-94319703 ATGAAGACACAGCAAGAAGGTGG + Intergenic
1014088969 6:117381394-117381416 TTGGAGACTCAGAAGGAGGGAGG - Intronic
1014701936 6:124699621-124699643 CTGGAGCAGCAGCAAGAGAGTGG - Intronic
1015210663 6:130694865-130694887 ATGGAGAAGCAGCAGCAGGAAGG + Intergenic
1015561981 6:134525743-134525765 ATGGCCAATCAGCAAGAGGGTGG + Intergenic
1015804411 6:137093861-137093883 CTGGAGCAGCAGCAAGAGAGAGG + Intergenic
1016903267 6:149123169-149123191 ATGGAGAAACAGCCAGCTGGTGG - Intergenic
1018212612 6:161496781-161496803 AGGGAGACACAGCAAGAAGGTGG + Intronic
1018297503 6:162364746-162364768 AAGGGGAATCAGGAAGAGGGAGG + Intronic
1018958915 6:168432288-168432310 CTGGAGGATGAGCAGGAGGGAGG + Intergenic
1019192591 6:170261851-170261873 ATGGAGAATCAGCAGGTGCACGG + Intergenic
1019328820 7:452816-452838 ATCAAGGGTCAGCAAGAGGGAGG + Intergenic
1019439982 7:1041122-1041144 ATGGAGAGACTGCAGGAGGGAGG + Intronic
1019705699 7:2496193-2496215 ATGCAGAGGCAGCAGGAGGGAGG + Intergenic
1020049318 7:5071765-5071787 ATGGAGAATGAACGAGAGTGAGG + Intronic
1021862228 7:24917207-24917229 ATGGAGAACAAGGAAGAGGCAGG - Intronic
1022563404 7:31373180-31373202 ATGGAGCATCAGCAAGGGGCAGG - Intergenic
1023988760 7:45115101-45115123 ATGATTATTCAGCAAGAGGGAGG + Intergenic
1024414835 7:49094915-49094937 ATTGAGCATCAGCAAGATGCAGG + Intergenic
1024730378 7:52247155-52247177 ATGGGGAATCATCTTGAGGGAGG + Intergenic
1025073263 7:55920004-55920026 ATGGAGGAACAGCCAGATGGTGG - Intronic
1026685454 7:72505511-72505533 CTGGAGAAACAGAAAGAGGCTGG + Intergenic
1026869156 7:73840344-73840366 ATGGAGGATCAGCAAGGGAAAGG + Intronic
1027362074 7:77419297-77419319 ACAGAGAATCAGCTAAAGGGAGG + Intergenic
1028607593 7:92671969-92671991 TTGGAGACTCAGAAAGGGGGAGG + Intronic
1028656999 7:93220033-93220055 TTTGAGAAACAGCAAGAGGCAGG + Intronic
1029124625 7:98287685-98287707 ATGGAGAATTAGGAAGCAGGAGG + Intronic
1032454366 7:132061682-132061704 ATGGAAGATGAGCATGAGGGTGG + Intergenic
1033658047 7:143386552-143386574 AAGCAGAAACAGGAAGAGGGTGG + Intronic
1033952762 7:146805572-146805594 AGGAAGGAACAGCAAGAGGGAGG + Intronic
1034050796 7:147982586-147982608 ATGGAGATTCATCAAGATGATGG + Intronic
1035522910 8:289833-289855 ATGGAGACTCTGAAAGAGGGAGG - Intergenic
1035589210 8:800363-800385 AAGGAGAATCAGCTAGATGTGGG + Intergenic
1035892500 8:3360483-3360505 CTGGGGAAACAGCAAGAAGGAGG - Intronic
1036604389 8:10292986-10293008 GTGGAGAAGCAGCAAGGAGGAGG + Intronic
1037004970 8:13767105-13767127 ATGGAGAATTAGAGAGAGGTGGG + Intergenic
1037279066 8:17215285-17215307 ACTGAGAATCAGTAAGAAGGTGG - Exonic
1037308610 8:17531201-17531223 ATAAAGAAGCAGCAAGAGCGGGG + Intronic
1039030149 8:33299803-33299825 AGGGAGAATCAGGAAGTGGTTGG - Intergenic
1039693526 8:39885331-39885353 ATGGACAATCAGCAGGAGGTGGG - Intergenic
1039818513 8:41115782-41115804 CTGGAGAAAGAGCAAGAGTGGGG - Intergenic
1041753653 8:61288754-61288776 ATGGAGAATCACCAGGAAGCAGG + Intronic
1042325035 8:67519362-67519384 CTGGAGATGCAGGAAGAGGGAGG - Intronic
1043208342 8:77476345-77476367 ATGAAGACACAGCAAGAAGGTGG + Intergenic
1043300581 8:78726060-78726082 ATGGAGAAAAAGCATGGGGGTGG + Intronic
1043411358 8:80000216-80000238 AATGAGGATCATCAAGAGGGAGG - Intronic
1043808272 8:84701636-84701658 CTGGAGGATCAGGAAGAGAGGGG + Intronic
1043821831 8:84875961-84875983 ATGGAGAATCTGAAAGTGTGGGG + Intronic
1044364423 8:91326410-91326432 GTGAGGAAGCAGCAAGAGGGAGG - Intronic
1045192916 8:99900909-99900931 AGGGAGAATGGGGAAGAGGGAGG - Intergenic
1045294883 8:100864023-100864045 ATGGAGGATGAGGAAGAGGAAGG - Intergenic
1046268732 8:111865118-111865140 TTGGAGAATTAGCATGAGAGGGG - Intergenic
1046739734 8:117815324-117815346 ATGGAGAATGAGGAAGATGTAGG + Intronic
1047508445 8:125497856-125497878 ATGGAGAGTCAGCAAGGTGGGGG + Intergenic
1048039210 8:130709173-130709195 ATGGAGAATTAGAATGAGGAGGG + Intergenic
1048046270 8:130776043-130776065 AAGGAGAAGCAGCAAGATTGGGG + Intergenic
1048858299 8:138702893-138702915 ATTGAGTATCAGTAAGAGTGTGG - Intronic
1049297336 8:141849745-141849767 AGGGAGGATCTACAAGAGGGAGG - Intergenic
1049336424 8:142089089-142089111 AAGGAGAAGCAGCCTGAGGGTGG + Intergenic
1049514380 8:143045659-143045681 GCTGAGAATCAGCCAGAGGGAGG - Intronic
1050500619 9:6294298-6294320 TTGGAGATTCAGAAAGAGGAAGG - Intergenic
1051969287 9:22867254-22867276 CAGGAGGATGAGCAAGAGGGAGG + Intergenic
1052243303 9:26301969-26301991 AAGGAGAAAGAGGAAGAGGGTGG - Intergenic
1052760561 9:32586841-32586863 ATGGAGAAACAGCCAGTTGGTGG + Intergenic
1053124904 9:35573014-35573036 ATGGAGAGACAGAAAGGGGGAGG + Intergenic
1053749103 9:41235444-41235466 CTGGAGTCTCAGCGAGAGGGTGG - Intergenic
1054336761 9:63815305-63815327 CTGGAGTCTCAGCGAGAGGGTGG + Intergenic
1054764147 9:69029007-69029029 AGGAAGAGGCAGCAAGAGGGCGG - Intergenic
1055758793 9:79584017-79584039 AGGGAGGATCAGCACGGGGGTGG + Intronic
1057289894 9:93798895-93798917 AAGGAGAAAGAGAAAGAGGGAGG - Intergenic
1058482531 9:105411391-105411413 ATGGAGACAGAGCAAGAGAGAGG - Intronic
1059496994 9:114718239-114718261 ATGAAGACACAGCAAGAAGGTGG + Intergenic
1059786998 9:117596914-117596936 AAGGAGAGTCAGCTAGTGGGAGG - Intergenic
1060342071 9:122786482-122786504 ATGGTGAAGCAGCATGAGAGAGG + Intergenic
1060434137 9:123579071-123579093 ATGGAGAAACAAAAACAGGGGGG + Intronic
1060900520 9:127253566-127253588 AGGGAGAGTCAGGAAGAAGGAGG + Intronic
1203417718 Un_KI270364v1:1653-1675 TTGTAGAATCTGCAAGAGGATGG - Intergenic
1203365275 Un_KI270442v1:250306-250328 CTGGAGTGTCAGCAAAAGGGAGG - Intergenic
1203376689 Un_KI270442v1:382730-382752 CTGGAGTGTCAGCGAGAGGGTGG + Intergenic
1187080287 X:15979042-15979064 CTGGAGACTCAGAAAGGGGGAGG + Intergenic
1187536880 X:20149053-20149075 GTGAAGAGGCAGCAAGAGGGCGG + Intergenic
1188158741 X:26774966-26774988 ATGGAGACTCAGAAAGGGGAAGG + Intergenic
1188538080 X:31219404-31219426 GTGGAGAATAAGAGAGAGGGCGG - Intronic
1188820204 X:34765761-34765783 ATGTAGGTTCAGCCAGAGGGAGG - Intergenic
1189339077 X:40190858-40190880 AGGGAGACACACCAAGAGGGAGG + Intergenic
1190522418 X:51294010-51294032 CTGGGGTATCAGCAACAGGGTGG + Intergenic
1192097084 X:68223534-68223556 TTGGAGACTCAGAAAAAGGGTGG + Intronic
1193465984 X:81848383-81848405 ATAGAAAATCAGAAAGATGGTGG + Intergenic
1193758941 X:85441429-85441451 ATGGAGAATGAAGAAAAGGGGGG - Intergenic
1193979184 X:88159897-88159919 ATGGAGACTCAGAATGATGGTGG - Intergenic
1195113960 X:101677094-101677116 AAGGGAAATCAGAAAGAGGGTGG - Intergenic
1195696773 X:107673289-107673311 CTGGAGAATCTGGAAGAGGCAGG - Intergenic
1196047514 X:111271635-111271657 ATGGAAATTCAGCTAGAGGTAGG + Intergenic
1197041524 X:121941333-121941355 ATGTAAAATTAGCAAGATGGAGG - Intergenic
1197166463 X:123382804-123382826 ATGTAGAATTAGCAAAAGCGAGG - Intronic
1197172009 X:123444812-123444834 ATGTAGAATTAACAAAAGGGAGG - Intronic
1197618410 X:128719967-128719989 ATGGAGACTCAGAAGGAGGATGG - Intergenic
1198250366 X:134874196-134874218 AAGAAGAATGAGCAAAAGGGGGG + Intergenic
1198292050 X:135249188-135249210 ATGGAGCATCAGGAGGAAGGTGG - Intronic
1199235611 X:145488809-145488831 AGGGAGAATGAGCAAGGGCGGGG + Intergenic
1201146592 Y:11068049-11068071 AGGGAGAAGAAGGAAGAGGGAGG + Intergenic
1201146606 Y:11068098-11068120 AGGGAGAAGAAGGAAGAGGGAGG + Intergenic
1201497112 Y:14600094-14600116 ATGTGGAAAGAGCAAGAGGGGGG - Intronic