ID: 987082457

View in Genome Browser
Species Human (GRCh38)
Location 5:14437814-14437836
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987082457_987082465 -1 Left 987082457 5:14437814-14437836 CCCGTAATCCCACCATCCTGGTA No data
Right 987082465 5:14437836-14437858 AGATTGTAATGATTTGGTTTGGG 0: 1
1: 1
2: 2
3: 23
4: 297
987082457_987082464 -2 Left 987082457 5:14437814-14437836 CCCGTAATCCCACCATCCTGGTA No data
Right 987082464 5:14437835-14437857 TAGATTGTAATGATTTGGTTTGG 0: 1
1: 0
2: 0
3: 21
4: 333
987082457_987082467 15 Left 987082457 5:14437814-14437836 CCCGTAATCCCACCATCCTGGTA No data
Right 987082467 5:14437852-14437874 GTTTGGGGCGATGTGAAATATGG 0: 1
1: 0
2: 0
3: 9
4: 100
987082457_987082466 0 Left 987082457 5:14437814-14437836 CCCGTAATCCCACCATCCTGGTA No data
Right 987082466 5:14437837-14437859 GATTGTAATGATTTGGTTTGGGG 0: 1
1: 0
2: 1
3: 14
4: 235
987082457_987082463 -7 Left 987082457 5:14437814-14437836 CCCGTAATCCCACCATCCTGGTA No data
Right 987082463 5:14437830-14437852 CCTGGTAGATTGTAATGATTTGG 0: 1
1: 0
2: 1
3: 5
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987082457 Original CRISPR TACCAGGATGGTGGGATTAC GGG (reversed) Intronic