ID: 987082463

View in Genome Browser
Species Human (GRCh38)
Location 5:14437830-14437852
Sequence CCTGGTAGATTGTAATGATT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 121}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987082457_987082463 -7 Left 987082457 5:14437814-14437836 CCCGTAATCCCACCATCCTGGTA No data
Right 987082463 5:14437830-14437852 CCTGGTAGATTGTAATGATTTGG 0: 1
1: 0
2: 1
3: 5
4: 121
987082458_987082463 -8 Left 987082458 5:14437815-14437837 CCGTAATCCCACCATCCTGGTAG No data
Right 987082463 5:14437830-14437852 CCTGGTAGATTGTAATGATTTGG 0: 1
1: 0
2: 1
3: 5
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987082463 Original CRISPR CCTGGTAGATTGTAATGATT TGG Intronic