ID: 987082464

View in Genome Browser
Species Human (GRCh38)
Location 5:14437835-14437857
Sequence TAGATTGTAATGATTTGGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 355
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 333}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987082457_987082464 -2 Left 987082457 5:14437814-14437836 CCCGTAATCCCACCATCCTGGTA No data
Right 987082464 5:14437835-14437857 TAGATTGTAATGATTTGGTTTGG 0: 1
1: 0
2: 0
3: 21
4: 333
987082458_987082464 -3 Left 987082458 5:14437815-14437837 CCGTAATCCCACCATCCTGGTAG No data
Right 987082464 5:14437835-14437857 TAGATTGTAATGATTTGGTTTGG 0: 1
1: 0
2: 0
3: 21
4: 333
987082459_987082464 -10 Left 987082459 5:14437822-14437844 CCCACCATCCTGGTAGATTGTAA 0: 1
1: 0
2: 0
3: 8
4: 98
Right 987082464 5:14437835-14437857 TAGATTGTAATGATTTGGTTTGG 0: 1
1: 0
2: 0
3: 21
4: 333

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987082464 Original CRISPR TAGATTGTAATGATTTGGTT TGG Intronic