ID: 987082465

View in Genome Browser
Species Human (GRCh38)
Location 5:14437836-14437858
Sequence AGATTGTAATGATTTGGTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 324
Summary {0: 1, 1: 1, 2: 2, 3: 23, 4: 297}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987082459_987082465 -9 Left 987082459 5:14437822-14437844 CCCACCATCCTGGTAGATTGTAA 0: 1
1: 0
2: 0
3: 8
4: 98
Right 987082465 5:14437836-14437858 AGATTGTAATGATTTGGTTTGGG 0: 1
1: 1
2: 2
3: 23
4: 297
987082458_987082465 -2 Left 987082458 5:14437815-14437837 CCGTAATCCCACCATCCTGGTAG No data
Right 987082465 5:14437836-14437858 AGATTGTAATGATTTGGTTTGGG 0: 1
1: 1
2: 2
3: 23
4: 297
987082460_987082465 -10 Left 987082460 5:14437823-14437845 CCACCATCCTGGTAGATTGTAAT 0: 1
1: 0
2: 0
3: 6
4: 100
Right 987082465 5:14437836-14437858 AGATTGTAATGATTTGGTTTGGG 0: 1
1: 1
2: 2
3: 23
4: 297
987082457_987082465 -1 Left 987082457 5:14437814-14437836 CCCGTAATCCCACCATCCTGGTA No data
Right 987082465 5:14437836-14437858 AGATTGTAATGATTTGGTTTGGG 0: 1
1: 1
2: 2
3: 23
4: 297

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987082465 Original CRISPR AGATTGTAATGATTTGGTTT GGG Intronic