ID: 987082466

View in Genome Browser
Species Human (GRCh38)
Location 5:14437837-14437859
Sequence GATTGTAATGATTTGGTTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 251
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 235}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987082458_987082466 -1 Left 987082458 5:14437815-14437837 CCGTAATCCCACCATCCTGGTAG No data
Right 987082466 5:14437837-14437859 GATTGTAATGATTTGGTTTGGGG 0: 1
1: 0
2: 1
3: 14
4: 235
987082459_987082466 -8 Left 987082459 5:14437822-14437844 CCCACCATCCTGGTAGATTGTAA 0: 1
1: 0
2: 0
3: 8
4: 98
Right 987082466 5:14437837-14437859 GATTGTAATGATTTGGTTTGGGG 0: 1
1: 0
2: 1
3: 14
4: 235
987082457_987082466 0 Left 987082457 5:14437814-14437836 CCCGTAATCCCACCATCCTGGTA No data
Right 987082466 5:14437837-14437859 GATTGTAATGATTTGGTTTGGGG 0: 1
1: 0
2: 1
3: 14
4: 235
987082460_987082466 -9 Left 987082460 5:14437823-14437845 CCACCATCCTGGTAGATTGTAAT 0: 1
1: 0
2: 0
3: 6
4: 100
Right 987082466 5:14437837-14437859 GATTGTAATGATTTGGTTTGGGG 0: 1
1: 0
2: 1
3: 14
4: 235

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987082466 Original CRISPR GATTGTAATGATTTGGTTTG GGG Intronic