ID: 987082467

View in Genome Browser
Species Human (GRCh38)
Location 5:14437852-14437874
Sequence GTTTGGGGCGATGTGAAATA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 100}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987082461_987082467 3 Left 987082461 5:14437826-14437848 CCATCCTGGTAGATTGTAATGAT No data
Right 987082467 5:14437852-14437874 GTTTGGGGCGATGTGAAATATGG 0: 1
1: 0
2: 0
3: 9
4: 100
987082459_987082467 7 Left 987082459 5:14437822-14437844 CCCACCATCCTGGTAGATTGTAA 0: 1
1: 0
2: 0
3: 8
4: 98
Right 987082467 5:14437852-14437874 GTTTGGGGCGATGTGAAATATGG 0: 1
1: 0
2: 0
3: 9
4: 100
987082457_987082467 15 Left 987082457 5:14437814-14437836 CCCGTAATCCCACCATCCTGGTA No data
Right 987082467 5:14437852-14437874 GTTTGGGGCGATGTGAAATATGG 0: 1
1: 0
2: 0
3: 9
4: 100
987082460_987082467 6 Left 987082460 5:14437823-14437845 CCACCATCCTGGTAGATTGTAAT 0: 1
1: 0
2: 0
3: 6
4: 100
Right 987082467 5:14437852-14437874 GTTTGGGGCGATGTGAAATATGG 0: 1
1: 0
2: 0
3: 9
4: 100
987082458_987082467 14 Left 987082458 5:14437815-14437837 CCGTAATCCCACCATCCTGGTAG No data
Right 987082467 5:14437852-14437874 GTTTGGGGCGATGTGAAATATGG 0: 1
1: 0
2: 0
3: 9
4: 100
987082462_987082467 -1 Left 987082462 5:14437830-14437852 CCTGGTAGATTGTAATGATTTGG 0: 1
1: 0
2: 2
3: 9
4: 117
Right 987082467 5:14437852-14437874 GTTTGGGGCGATGTGAAATATGG 0: 1
1: 0
2: 0
3: 9
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987082467 Original CRISPR GTTTGGGGCGATGTGAAATA TGG Intronic