ID: 987082808

View in Genome Browser
Species Human (GRCh38)
Location 5:14440993-14441015
Sequence GCGCGCGCGCGCGCTGCAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 118}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987082808_987082810 -4 Left 987082808 5:14440993-14441015 CCAACTGCAGCGCGCGCGCGCGC 0: 1
1: 0
2: 1
3: 12
4: 118
Right 987082810 5:14441012-14441034 GCGCGCTCAGACGCCAGCGAGGG 0: 1
1: 0
2: 0
3: 2
4: 46
987082808_987082816 17 Left 987082808 5:14440993-14441015 CCAACTGCAGCGCGCGCGCGCGC 0: 1
1: 0
2: 1
3: 12
4: 118
Right 987082816 5:14441033-14441055 GGAGAGGCGCGCGCTGGGCCGGG 0: 1
1: 0
2: 3
3: 53
4: 832
987082808_987082815 16 Left 987082808 5:14440993-14441015 CCAACTGCAGCGCGCGCGCGCGC 0: 1
1: 0
2: 1
3: 12
4: 118
Right 987082815 5:14441032-14441054 GGGAGAGGCGCGCGCTGGGCCGG 0: 1
1: 0
2: 4
3: 51
4: 486
987082808_987082809 -5 Left 987082808 5:14440993-14441015 CCAACTGCAGCGCGCGCGCGCGC 0: 1
1: 0
2: 1
3: 12
4: 118
Right 987082809 5:14441011-14441033 CGCGCGCTCAGACGCCAGCGAGG 0: 1
1: 0
2: 1
3: 2
4: 40
987082808_987082818 24 Left 987082808 5:14440993-14441015 CCAACTGCAGCGCGCGCGCGCGC 0: 1
1: 0
2: 1
3: 12
4: 118
Right 987082818 5:14441040-14441062 CGCGCGCTGGGCCGGGCCGTGGG 0: 1
1: 0
2: 2
3: 16
4: 199
987082808_987082819 28 Left 987082808 5:14440993-14441015 CCAACTGCAGCGCGCGCGCGCGC 0: 1
1: 0
2: 1
3: 12
4: 118
Right 987082819 5:14441044-14441066 CGCTGGGCCGGGCCGTGGGCTGG 0: 1
1: 1
2: 3
3: 59
4: 502
987082808_987082817 23 Left 987082808 5:14440993-14441015 CCAACTGCAGCGCGCGCGCGCGC 0: 1
1: 0
2: 1
3: 12
4: 118
Right 987082817 5:14441039-14441061 GCGCGCGCTGGGCCGGGCCGTGG 0: 1
1: 1
2: 9
3: 80
4: 602
987082808_987082814 12 Left 987082808 5:14440993-14441015 CCAACTGCAGCGCGCGCGCGCGC 0: 1
1: 0
2: 1
3: 12
4: 118
Right 987082814 5:14441028-14441050 GCGAGGGAGAGGCGCGCGCTGGG 0: 1
1: 0
2: 2
3: 25
4: 192
987082808_987082811 1 Left 987082808 5:14440993-14441015 CCAACTGCAGCGCGCGCGCGCGC 0: 1
1: 0
2: 1
3: 12
4: 118
Right 987082811 5:14441017-14441039 CTCAGACGCCAGCGAGGGAGAGG 0: 1
1: 0
2: 1
3: 18
4: 149
987082808_987082813 11 Left 987082808 5:14440993-14441015 CCAACTGCAGCGCGCGCGCGCGC 0: 1
1: 0
2: 1
3: 12
4: 118
Right 987082813 5:14441027-14441049 AGCGAGGGAGAGGCGCGCGCTGG 0: 1
1: 0
2: 2
3: 61
4: 704

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987082808 Original CRISPR GCGCGCGCGCGCGCTGCAGT TGG (reversed) Intronic
901526105 1:9824170-9824192 CCGCGGGCGCGCGCTCCAGGCGG - Exonic
901641433 1:10694890-10694912 GCGAGCGCGCGCGCGGCCGCCGG - Intronic
902465374 1:16613938-16613960 GCACGGGCACGCGGTGCAGTCGG + Intergenic
907526480 1:55056869-55056891 GCGCGCGCGCGCGTTGGGGGTGG + Intronic
912556457 1:110519740-110519762 GTGCGCGCGCACGCTGGAGGTGG + Intergenic
912993506 1:114511202-114511224 GCGTGCGCGCGCGCTCTCGTTGG - Intergenic
914869120 1:151458811-151458833 GCGCGCGCGCGCGCCGCGGCGGG + Intronic
918480688 1:184974161-184974183 TCGCGCGGGCGGGCTGCGGTCGG + Intronic
919793906 1:201309672-201309694 GCACGTGCGCCCGCTGCAGGTGG - Intronic
923007826 1:230066809-230066831 ACGTGTGCGCGCGCTCCAGTCGG + Intronic
1065188703 10:23192335-23192357 GCCCGCGCTCGCGCTGCGCTGGG - Exonic
1070835683 10:79445619-79445641 GCGCGCGCCGGGGCCGCAGTCGG - Exonic
1071573701 10:86711435-86711457 GGGCGGGCGCGCGCTGGAGTCGG + Intronic
1071618204 10:87095065-87095087 GCGCACGCTCGCGCGCCAGTGGG + Intronic
1071997566 10:91163004-91163026 GCGCGCGCGCGTGGGGCGGTAGG - Intronic
1073287951 10:102399653-102399675 GGACGCGCGCGCGCTGCTGGCGG + Exonic
1074503275 10:114044636-114044658 GCGCCCGCGCGCGCGTCAGCAGG - Exonic
1075129559 10:119726295-119726317 GCGCGCGCTCGCCCTGCTGCAGG - Exonic
1075877704 10:125822223-125822245 GCTGGCGCTCGCTCTGCAGTTGG + Intronic
1077322318 11:1947808-1947830 GGCCGCGCCCGCGCTGCGGTGGG - Intronic
1081672849 11:44951051-44951073 GCGCGTGCGCCCCCTGCAGGCGG - Intronic
1081845447 11:46237841-46237863 GGGCGCGCCCGGGCTGCAGGCGG + Intergenic
1082035552 11:47642563-47642585 GCGTGCGCGCGCGCCGCGGGCGG - Exonic
1082928849 11:58579068-58579090 GCGCGCGCGCGCGCCGCCAGCGG + Intergenic
1087102830 11:94381575-94381597 GTGTGCGCGCGTGCTGCAGGTGG + Intronic
1090699345 11:129279748-129279770 GAGCGCACGTGCGCTGCGGTGGG + Intergenic
1202805336 11_KI270721v1_random:3121-3143 GGCCGCGCCCGCGCTGCGGTGGG - Intergenic
1092204695 12:6607586-6607608 GCGCGCGCGCCCGCTGCGAAGGG - Intergenic
1108408081 13:50124563-50124585 GCGCGCGCGCGGGCTTCGGCGGG - Intronic
1118323159 14:64765042-64765064 GCGCGCGCGCGCGCGGGTGGTGG + Intronic
1118874055 14:69767693-69767715 GAGCGCCCGCCCGCTGCTGTTGG + Intronic
1122940378 14:104978458-104978480 GCGCTCGCGGGCGGTGCCGTCGG + Intergenic
1124952702 15:34338052-34338074 GAGCGCAGGCGCGCTGCACTCGG - Intronic
1125329090 15:38564818-38564840 GAGCGCGCGCGCGAGGCAGAGGG - Intronic
1125521960 15:40353147-40353169 GCGCGCGCGCGCGCATCCGTGGG + Intronic
1127868192 15:63048538-63048560 GCGGGCGGGAGGGCTGCAGTGGG - Intronic
1129503207 15:76059798-76059820 GGGCGCGCGCGCGCGGCCGGCGG + Intergenic
1133188483 16:4116472-4116494 CCGCGCGTGCGCGCTGCGGCTGG - Intergenic
1134014514 16:10879007-10879029 GCTCCCGCGCGCGCTGCTGGTGG - Intronic
1134131027 16:11650369-11650391 GCGCGCGCGCGCGCTGTCCATGG - Intergenic
1135040520 16:19114158-19114180 GCGCCCCCGCGCGCCGCCGTCGG - Intronic
1140225123 16:73070909-73070931 GCGCGCGCGCGCGCGCAAGACGG - Intergenic
1141116615 16:81315024-81315046 GCGGGCGCGCGCGCAGGACTCGG + Exonic
1143495035 17:7307899-7307921 GCGCGGGCGCGCGCCCCGGTTGG + Intronic
1145969664 17:28949697-28949719 GCCCGCGCGCCCGCTGCCCTCGG - Intronic
1146053008 17:29567465-29567487 CCGCGCGCGCGCTCTGCCCTCGG + Intronic
1147612801 17:41811661-41811683 GGGCGCGGGGCCGCTGCAGTTGG + Exonic
1147710441 17:42459404-42459426 GGGCGCGGGGGCGCTGTAGTTGG + Intronic
1147864957 17:43545983-43546005 GCGCGCGCGCGCGGAGGAGCAGG + Intronic
1148271734 17:46266930-46266952 CCGCGCGCGCGCGCCGCCGAGGG + Intergenic
1150446179 17:65228438-65228460 GCCCGCGTGCTCCCTGCAGTTGG + Intergenic
1151218339 17:72592790-72592812 CCGCCTGCGCGCCCTGCAGTCGG + Intergenic
1152352147 17:79790033-79790055 ACGCGCGCGCCCTCTGCAGGTGG - Intergenic
1155130959 18:22933830-22933852 GCGCGCGCGCGAGCCGCAGTCGG - Exonic
1156448609 18:37254085-37254107 ACGCGCGCGCGGGCTGGAGAGGG - Intronic
1158509334 18:58076654-58076676 GCGGGCGGGCGGGCTGGAGTTGG + Intronic
1160992031 19:1863935-1863957 ACGGGGGCGCGCGCTGGAGTGGG - Intergenic
1161707235 19:5827846-5827868 GCGCACGCGCGCGCCGCCGCCGG - Exonic
1162100366 19:8335262-8335284 GCTCGCGCACCAGCTGCAGTTGG + Exonic
1163708635 19:18832402-18832424 GCGGGCGCGGGCGCTGCGGCGGG + Exonic
1165157569 19:33797290-33797312 GCGCGCGCGCGCGCTTGTGGAGG + Intronic
1165553202 19:36605675-36605697 GCGCGGGCGCGCGCTGAATAGGG + Intronic
1166366226 19:42279970-42279992 GCGCGCGCATGCGCGGCAGAGGG + Intronic
1166727758 19:45039070-45039092 CCGCGCGCGAGCGCAGCGGTGGG + Exonic
1167079947 19:47271745-47271767 GCGCGCGCGCGCGCGCTAGAGGG + Exonic
1167509829 19:49890188-49890210 GCGCGAGGGCGCGCTGCTGCTGG - Exonic
1168408073 19:56121032-56121054 GCGCGCGTGCGCGCTGCTGGGGG - Intronic
926020186 2:9487838-9487860 GCGCGCGCGCGCGCTGTGGGGGG + Intronic
928186469 2:29115475-29115497 GGGCGCGCGCGCAGTGCAGGCGG - Exonic
929313284 2:40450370-40450392 GCACGCGCGCGCGCTGGTGGGGG + Intronic
935622872 2:105144228-105144250 TCGCGGGCGCTCCCTGCAGTGGG + Intergenic
942034730 2:171999848-171999870 GCGCGCACGCGCGCTCCCCTCGG + Exonic
947119238 2:226799131-226799153 GCGCGCGCGCGCGCTCCTGGAGG - Exonic
947669372 2:231926623-231926645 GGGCGCGCGCTCGCTGCAAATGG - Intergenic
948910052 2:240998431-240998453 GCGGGCGCGCGCCCTGTGGTGGG - Intergenic
1168855031 20:1002241-1002263 GCGGGCGCGGGGGCTGCTGTGGG + Exonic
1175397270 20:58675091-58675113 GCACGCGCGTGCTCGGCAGTCGG + Intronic
1176555787 21:8253491-8253513 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
1176574724 21:8436525-8436547 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
1176611338 21:8987818-8987840 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
1181574895 22:23787373-23787395 GCGCGCGCGCTCGGGGCTGTGGG + Intronic
1185387819 22:50544380-50544402 GCGCTCGCGCGCGCTGCCAACGG + Intergenic
1203252772 22_KI270733v1_random:125576-125598 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
1203260828 22_KI270733v1_random:170662-170684 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
953410079 3:42685819-42685841 GCGCGCGGGCGAGCTGCACCTGG + Exonic
956179087 3:66500933-66500955 GCGCGCGCGCGCGCAGCCTCGGG + Intronic
956659449 3:71583630-71583652 GTGCGCGCGCGGGCGGGAGTGGG - Intronic
957371554 3:79300597-79300619 GCGTGCAGGCGCACTGCAGTGGG + Intronic
959423450 3:106156004-106156026 ACGCGCGCACGCGGTGCAGGAGG + Intergenic
968701434 4:2059841-2059863 GCGCGCGCGGGTGCTGCCGCAGG - Exonic
984167447 4:176319908-176319930 GGGCGCGCGCGCGCTCGCGTCGG + Intergenic
984805310 4:183746526-183746548 GCTCGCTCCCGCCCTGCAGTGGG - Intergenic
987082808 5:14440993-14441015 GCGCGCGCGCGCGCTGCAGTTGG - Intronic
992496889 5:77302499-77302521 GCACCCGCTCCCGCTGCAGTGGG - Intronic
992627430 5:78648460-78648482 GGGCCCGCGCGCGCTGCGGGAGG - Intronic
996308571 5:122077883-122077905 GCTCGCGCGGGGGCTGCTGTTGG + Exonic
997237157 5:132279336-132279358 GCGCGCGCGCGCGTGGGTGTCGG - Intronic
1001083443 5:168683674-168683696 GCGGGAGTGCGCGCTGCAGTGGG - Intronic
1002184201 5:177446741-177446763 GCGTGCGCGCGCGCGGCAGCCGG - Intronic
1002559738 5:180072910-180072932 GCGCGCGCGCGCGTTTCGGAAGG - Intergenic
1002887768 6:1311837-1311859 GGGAGCGCGCGCGCCGCTGTGGG - Intergenic
1003018736 6:2491250-2491272 ACGCTCGCGCGCGCTGGGGTTGG - Intergenic
1004044827 6:12012976-12012998 GAGTGCGCGCCAGCTGCAGTTGG + Intronic
1004720442 6:18264208-18264230 GCGCGCGCACGCGGGGCAGCGGG - Intronic
1007451311 6:41941772-41941794 GCGCGCGCGCGGGCGGCGGGCGG - Exonic
1012872901 6:104693059-104693081 ACGCGCGCGCGCGCTGGGGTGGG + Intergenic
1013507567 6:110815234-110815256 GCGCGCGCGCGCGCGAGAGGCGG - Exonic
1019529742 7:1497399-1497421 GCGCCCGAGGGCGCTGCAGTGGG + Intronic
1019619444 7:1983125-1983147 GCGCGCGCGCGCGCGTCTGTGGG - Intronic
1021558592 7:21946064-21946086 GCGCGAGAGGGGGCTGCAGTTGG + Exonic
1022230769 7:28410138-28410160 GCGCGCCCACCCGCTGCAGCCGG - Intronic
1022715188 7:32891997-32892019 GCGCGCGCGCGCGAGGCGGGAGG - Intronic
1022715192 7:32892006-32892028 TCGCGCGCGCGCGCGCCTGTCGG + Intronic
1024043793 7:45574378-45574400 GGGCGCGCGCGCGGGGCAGCCGG + Intronic
1024520959 7:50304077-50304099 GCGGGCGAGCGGGCTGCAGCCGG + Intergenic
1029055127 7:97733133-97733155 GCACACGCGCGAGCTGCAGGGGG + Intronic
1032781895 7:135170508-135170530 GAGCGCGCGGCCGCTCCAGTCGG - Intronic
1034243199 7:149624928-149624950 GCGCGCGCACACGCGGCAGTCGG - Intergenic
1038767911 8:30446845-30446867 GCGCGCGCGCGCGCGGTGGAGGG + Intronic
1041708041 8:60867410-60867432 GCGCGCGTGCGTGCTTAAGTGGG - Exonic
1049145983 8:141001300-141001322 CCGCGCGCGTGCGCGGCAGCCGG + Intronic
1049548861 8:143247090-143247112 GCGCGTCCGCGCTCTGCAGCGGG + Exonic
1052596991 9:30574420-30574442 GCGAGAGCGCCAGCTGCAGTGGG + Intergenic
1058058549 9:100473238-100473260 GCGGGCGCGCGCGCGGCGGGCGG - Exonic
1062406618 9:136399858-136399880 GCACGCGGGCGCCCTGCAGCCGG + Intergenic
1062567463 9:137169709-137169731 GCGCCTGCGCGCGCTGCTGCTGG - Exonic
1203469175 Un_GL000220v1:108727-108749 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
1203476996 Un_GL000220v1:152699-152721 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
1185457610 X:318669-318691 GCGCGCGCGCTAGCCGCTGTCGG - Exonic
1187675774 X:21715316-21715338 GCGCGCTCGCGCGCTGGTGGGGG + Intronic
1190881652 X:54496007-54496029 GCGCGCGTGTGCGCTGCGCTTGG + Exonic
1200092909 X:153644199-153644221 GCGCGCGCGAGGCCTGCAGGCGG + Intronic